ID: 920636741

View in Genome Browser
Species Human (GRCh38)
Location 1:207711584-207711606
Sequence GGGCACATCAATGCAAATTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 1, 2: 7, 3: 27, 4: 120}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920636741_920636746 1 Left 920636741 1:207711584-207711606 CCTCAATTTGCATTGATGTGCCC 0: 1
1: 1
2: 7
3: 27
4: 120
Right 920636746 1:207711608-207711630 TTAACTTACCTGTAATTGGCTGG 0: 1
1: 0
2: 0
3: 12
4: 150
920636741_920636747 2 Left 920636741 1:207711584-207711606 CCTCAATTTGCATTGATGTGCCC 0: 1
1: 1
2: 7
3: 27
4: 120
Right 920636747 1:207711609-207711631 TAACTTACCTGTAATTGGCTGGG 0: 1
1: 0
2: 0
3: 7
4: 121
920636741_920636750 10 Left 920636741 1:207711584-207711606 CCTCAATTTGCATTGATGTGCCC 0: 1
1: 1
2: 7
3: 27
4: 120
Right 920636750 1:207711617-207711639 CTGTAATTGGCTGGGCATGGTGG 0: 2
1: 7
2: 161
3: 2306
4: 32143
920636741_920636748 7 Left 920636741 1:207711584-207711606 CCTCAATTTGCATTGATGTGCCC 0: 1
1: 1
2: 7
3: 27
4: 120
Right 920636748 1:207711614-207711636 TACCTGTAATTGGCTGGGCATGG 0: 1
1: 0
2: 10
3: 123
4: 1033
920636741_920636743 -3 Left 920636741 1:207711584-207711606 CCTCAATTTGCATTGATGTGCCC 0: 1
1: 1
2: 7
3: 27
4: 120
Right 920636743 1:207711604-207711626 CCCCTTAACTTACCTGTAATTGG 0: 1
1: 0
2: 0
3: 7
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920636741 Original CRISPR GGGCACATCAATGCAAATTG AGG (reversed) Intronic
901074921 1:6548074-6548096 GGCCACGCCAATGCAAATTTTGG - Intronic
901427678 1:9192958-9192980 GTGCACATCAAGGCAGTTTGTGG + Intergenic
905321035 1:37117536-37117558 AGGCACATCAAGGCAAACTATGG - Intergenic
909051988 1:70777197-70777219 GGGCAGGTTAATGCAAATTGAGG - Intergenic
916338031 1:163695167-163695189 GGGTACATCTAGGAAAATTGAGG - Intergenic
916412965 1:164565055-164565077 GGGCACTTAAATGTACATTGTGG + Intronic
920636741 1:207711584-207711606 GGGCACATCAATGCAAATTGAGG - Intronic
921802312 1:219415598-219415620 TTGCACTTCAATGGAAATTGAGG + Intergenic
921802405 1:219416615-219416637 AGGTTGATCAATGCAAATTGAGG + Intergenic
922968607 1:229715315-229715337 GGACAGGTTAATGCAAATTGAGG - Intergenic
922972609 1:229755600-229755622 GGTCCCACCAATGCAAATTCTGG + Intergenic
923077690 1:230624568-230624590 GGTCACATCAATGGATATTTGGG + Intergenic
924273050 1:242354306-242354328 GGGTGGATCAATGCAAATTCAGG - Intronic
1064800469 10:19064954-19064976 GAGCAGATTAATGCAAATTGAGG + Intronic
1066711662 10:38242353-38242375 GGGTGGATCAATGCAAATTCAGG + Intergenic
1069123956 10:64606009-64606031 GGGCACATGAAGGAAAGTTGAGG - Intergenic
1069167411 10:65179611-65179633 GGCCACATCATTGACAATTGTGG + Intergenic
1069650298 10:70042448-70042470 GCGCACATCAAAGGATATTGGGG - Intergenic
1071874379 10:89828577-89828599 GGGCACATTATTGAAAATTTTGG + Intergenic
1076942652 10:133620116-133620138 GTTCACATCCATGCTAATTGAGG + Intergenic
1079820926 11:25127297-25127319 GGTCAGATCAATCCAACTTGTGG - Intergenic
1080463195 11:32473562-32473584 GGGCAGGTCAATGCAAACTGAGG - Intergenic
1080843279 11:36004427-36004449 GGGCACACCGATGCAAAAGGTGG + Intronic
1081368269 11:42264065-42264087 AGGCAGATTAATGCCAATTGTGG - Intergenic
1085129388 11:74025161-74025183 GGCCACATTAATGAAAAATGGGG - Intronic
1085129564 11:74026522-74026544 GGCCACATTAATGAAAAATGGGG - Intronic
1086554424 11:88091926-88091948 AGGCACGTCAATGGAAATTGAGG + Intergenic
1087375829 11:97338690-97338712 GGACACATTAATGAAAAGTGGGG - Intergenic
1103879006 12:124151693-124151715 GGGCAGGTTAATGCAAATTGAGG + Intronic
1104116007 12:125749409-125749431 GGGCACACCAATGCAAGGGGTGG - Intergenic
1105035141 12:132913968-132913990 GGGCAAATCAATGAAAATAGTGG - Intronic
1109805238 13:67430967-67430989 GGAAACATCAATCCCAATTGAGG - Intergenic
1110497055 13:76180350-76180372 GGGCAGATTAATGCAAATTGAGG - Intergenic
1111179599 13:84645781-84645803 GGGTGGATCAATGCAAATTGAGG + Intergenic
1112582487 13:100688435-100688457 GGGCAGATTAATGCACATTGGGG + Intergenic
1115879053 14:37894282-37894304 GGGTACTGCAATGTAAATTGTGG - Intronic
1116244878 14:42397025-42397047 AGGCACATGAATGGAAATTTAGG + Intergenic
1116259350 14:42602982-42603004 GGGCAGGTTAATGCAAATTGAGG + Intergenic
1117218946 14:53581877-53581899 GGGTACATCATTGCACATAGTGG - Intergenic
1120246960 14:82018786-82018808 GGGAAGATCAATACAAATTTTGG - Intergenic
1121513993 14:94536843-94536865 GGGCAGTTTAGTGCAAATTGAGG + Intergenic
1123124818 14:105938533-105938555 GGGCACATGCATGCACATGGTGG - Intergenic
1123835205 15:24182977-24182999 GGGCAAGTCAAGGCAAATTGAGG + Intergenic
1123849961 15:24344332-24344354 GGGGCAGTCAATGCAAATTGAGG + Intergenic
1123854901 15:24398888-24398910 GGGCAGGTCAATGCAAATTGAGG + Intergenic
1123870931 15:24571872-24571894 GGGCAGATCAATGCAAATTGAGG + Intergenic
1125349342 15:38751586-38751608 GGGCACATCAGGGCAAATTCAGG + Intergenic
1126942386 15:53780869-53780891 GGGCACGTTAATGCAAAAGGCGG + Intergenic
1127288083 15:57547776-57547798 AGGGACAGCAATGCAAATAGTGG - Exonic
1129981172 15:79872616-79872638 GGGCAGGTCAATGCAAATTGAGG + Intronic
1135271298 16:21071938-21071960 GGGCACATCAGTTCACAGTGTGG - Intronic
1138777434 16:59740914-59740936 GGGAAGGTTAATGCAAATTGAGG + Intronic
1139102900 16:63789611-63789633 GGGATGATCAATGCAAATTGTGG + Intergenic
1140291232 16:73659682-73659704 GGGCACAGAACTGCAAATGGAGG - Intergenic
1142323971 16:89402387-89402409 AGGCACATCAATTTAAATTTAGG + Intronic
1145022644 17:19443615-19443637 GGGAACACCAATGCAAAAGGTGG - Intergenic
1146087973 17:29847876-29847898 GGGCAGGTTAATGCAAATTGAGG - Intronic
1149604697 17:57916439-57916461 GGGCAAATCGATGCCAAGTGGGG - Intronic
1151273442 17:73014673-73014695 GGGCACATACAAGCAAACTGGGG + Intronic
1154178579 18:12108907-12108929 GGGCACACTGATGCAAAATGTGG + Intronic
1158625733 18:59070069-59070091 GGTCTCATCGCTGCAAATTGAGG - Intergenic
1159337065 18:67081978-67082000 GGTCAAATGCATGCAAATTGAGG - Intergenic
1162001767 19:7749111-7749133 GGGTGGGTCAATGCAAATTGAGG - Intergenic
930683221 2:54279989-54280011 GGGAAGATAAATGCAAGTTGTGG + Intronic
930903092 2:56532038-56532060 GGGCACATCAGTACAAATTGAGG + Intergenic
931965433 2:67528671-67528693 GTGCAGGTTAATGCAAATTGAGG - Intergenic
933486888 2:82935445-82935467 GGGTGGGTCAATGCAAATTGAGG - Intergenic
935815420 2:106842657-106842679 GGGCATATCCATGCAGACTGCGG + Intronic
937098527 2:119251057-119251079 GGGCACATCCAAGCAGATTCTGG + Intronic
939333728 2:140798491-140798513 GGGCCCATCATTACAAATTTTGG - Intronic
942233851 2:173885217-173885239 TAGCACAGCAATGCTAATTGAGG - Intergenic
942382088 2:175402279-175402301 GGCCACATCACTCCAAAATGAGG - Intergenic
943783349 2:191848963-191848985 GCGCAAATCAATGCAAAATCAGG - Intergenic
944006203 2:194909992-194910014 GAGCAAATCAATGCATCTTGTGG + Intergenic
946653735 2:221921981-221922003 GGTCAGAGCAATACAAATTGTGG - Intergenic
947945545 2:234098633-234098655 GGAAATATCAATGTAAATTGTGG + Intergenic
1168909418 20:1435227-1435249 GGGCAAGCCAATGCAAACTGAGG - Intergenic
1169035415 20:2447151-2447173 GGGCAGGTTGATGCAAATTGAGG - Intergenic
1169217731 20:3803195-3803217 GGGCACATCAAGGTAAGATGGGG + Exonic
1171325011 20:24283460-24283482 GGGCAGGTCAATACAAATTAAGG + Intergenic
1172570712 20:35968188-35968210 GGGCAGGTTAATGCAAATTAAGG + Intronic
1173308103 20:41871170-41871192 GAACAGGTCAATGCAAATTGAGG - Intergenic
1173891978 20:46519782-46519804 GAGTGGATCAATGCAAATTGAGG - Intergenic
1174117761 20:48239129-48239151 GAGCACATCAAGGAAAAATGTGG - Intergenic
1180236772 21:46465607-46465629 GGGCACTTTAACGTAAATTGAGG + Intronic
956589850 3:70903122-70903144 GTCCACATAAATGCAAATTTAGG + Intergenic
956722445 3:72130200-72130222 GGGCATTTCACTGCAAATTTGGG + Intergenic
959603566 3:108217207-108217229 TGGCACATAACTGCAAATTTTGG - Intronic
959770636 3:110090911-110090933 GGGCAAGTCAATGCAAATTGAGG + Intergenic
963745734 3:149123780-149123802 GGCCAGACCAATGCAATTTGAGG - Intergenic
963921897 3:150913775-150913797 GGTTAGATCAAGGCAAATTGTGG + Intronic
964250557 3:154711443-154711465 TGGCACATATATGCATATTGGGG + Intergenic
969218466 4:5743014-5743036 GGGCAGTTCATTGCAAATTGAGG + Intronic
971156814 4:24091970-24091992 TGGCAGAACAATGCAAATTCTGG - Intergenic
971644148 4:29174802-29174824 TGGCATATCAATGCAAACTGTGG + Intergenic
972441653 4:39099383-39099405 GGGGAGATCAATGCATATTGAGG - Intronic
972508908 4:39748721-39748743 GGTCACAGTAATACAAATTGGGG - Intronic
974483914 4:62481928-62481950 GAGGACAGCAATGCAAATAGTGG - Intergenic
981303437 4:143217839-143217861 TGGGAAAACAATGCAAATTGTGG + Intronic
981376145 4:144018237-144018259 GGGAACATTAAGGCAAATTAAGG - Intronic
984816897 4:183847367-183847389 GGGCAAAGAAATACAAATTGGGG - Intergenic
985136653 4:186792982-186793004 GGGCAGGTTAATGCAAATTGAGG + Intergenic
985334538 4:188877859-188877881 GGGAGCTACAATGCAAATTGAGG - Intergenic
985700465 5:1368840-1368862 GGACAGGTCAATGCAAATTAAGG - Intergenic
985701433 5:1375487-1375509 GTAGAGATCAATGCAAATTGAGG - Intergenic
986576207 5:9215384-9215406 GGTCACATTCATGAAAATTGGGG - Intronic
988025699 5:25686007-25686029 ATGCAAATCAATGCAATTTGTGG + Intergenic
989311324 5:40022121-40022143 AGGCATGTCAATGCAAATTTAGG + Intergenic
989516404 5:42348507-42348529 GGTCACACCAATGCAAGTGGTGG - Intergenic
992238231 5:74734966-74734988 GAGCACCTAAATTCAAATTGTGG - Intronic
994842110 5:104937909-104937931 GGAAATATTAATGCAAATTGAGG - Intergenic
997065446 5:130554186-130554208 GGGTGGGTCAATGCAAATTGAGG - Intergenic
1000194337 5:158943179-158943201 GGTCACATTAATGCAAACAGAGG + Intronic
1000304747 5:159984986-159985008 GGGCAGACCATTGCAAAGTGTGG - Intergenic
1001182241 5:169531285-169531307 GGTCATATCAATGGGAATTGGGG - Intergenic
1001232243 5:169998659-169998681 GAGCACATCAATGCAAAGTTGGG + Intronic
1003249642 6:4414868-4414890 AGGCACATCAAGGAAAATTTGGG - Intergenic
1006675465 6:35759487-35759509 GGCCACATCACTGGAAAGTGGGG + Intergenic
1010865954 6:80976978-80977000 GGGCAGGTCAATGCAAATTGAGG - Intergenic
1010866606 6:80983337-80983359 GGGAAGGTCAATGCAAATTGAGG - Intergenic
1011167927 6:84471114-84471136 AAGCACATCAATGCAAATGGTGG + Intergenic
1011888212 6:92124497-92124519 GGGGACAGCAATGAAAAGTGTGG + Intergenic
1014480363 6:121928372-121928394 GGGCTGATTAATGCTAATTGTGG - Intergenic
1016519575 6:144931464-144931486 AGGCAGGTCAATGCAAATTGAGG + Intergenic
1017980418 6:159396160-159396182 TGGCATACCAATGCAAATAGAGG - Intergenic
1023159812 7:37286145-37286167 AGGCAAAACAATGCAAATAGTGG + Intronic
1026026746 7:66751611-66751633 GGGCAAATCAGAGCAAAATGCGG - Intronic
1026685099 7:72503266-72503288 GGGCACTGCAATGGAAATAGGGG - Intergenic
1028035407 7:85975474-85975496 GGGCAGCTCAATGCAAAGTGAGG + Intergenic
1028317910 7:89427065-89427087 GGGTGGGTCAATGCAAATTGGGG + Intergenic
1028835328 7:95368368-95368390 GGGCACTTTGATGCAAATTAAGG + Intronic
1030776765 7:113543307-113543329 GGACGAGTCAATGCAAATTGAGG - Intergenic
1030967874 7:116016428-116016450 GGGAACAGAAATGCAAATTTGGG - Intronic
1031237305 7:119192458-119192480 GGGTACTACAATACAAATTGAGG - Intergenic
1033212797 7:139472734-139472756 GGGCTTCTCAATTCAAATTGGGG - Intronic
1039157654 8:34579691-34579713 TGGCAGATCAATGTAAATTGAGG - Intergenic
1039480152 8:37867171-37867193 AGGGACAGCAATGAAAATTGGGG - Intronic
1050584132 9:7092450-7092472 GGTCAGATTAATGCAAAATGAGG - Intergenic
1050956745 9:11671418-11671440 GGGAACAAAAATGCAGATTGAGG - Intergenic
1051354937 9:16232660-16232682 GGGGAAATAAATGGAAATTGTGG + Intronic
1052688207 9:31780700-31780722 GGTCACATTGATGCAAAATGTGG + Intergenic
1056921796 9:90797407-90797429 GGGAACCTCAATGCAAACTTTGG + Intergenic
1189910148 X:45802790-45802812 GGACACCTCAATCCAAATTGAGG - Intergenic
1190364636 X:49680108-49680130 GGGTCAGTCAATGCAAATTGAGG + Intergenic
1190554767 X:51623081-51623103 GGGCAGGTCAATGCAAATTGAGG + Intergenic
1190953319 X:55167455-55167477 GGGCAGGTTAATGCAAGTTGAGG - Intronic
1193700448 X:84754135-84754157 GTGTACCTCAATGCAAATTATGG - Intergenic
1193930610 X:87546768-87546790 GGGCACATTGATGCAAAGGGTGG - Intronic
1194152789 X:90345696-90345718 GGGGTGGTCAATGCAAATTGAGG + Intergenic
1194409778 X:93543605-93543627 GGGCACATCAATGCAAGGGGTGG + Intergenic
1194589644 X:95783681-95783703 GTGTACATCAATGCAAAATGGGG + Intergenic
1194938213 X:99977341-99977363 AGGCCCATAAATGCAATTTGAGG + Intergenic
1195389221 X:104343689-104343711 GGGCAGGTTAATGCAAATTGAGG + Intergenic
1198320278 X:135513221-135513243 AGGCACATCACAGCAAATTCAGG + Intergenic
1199071224 X:143477406-143477428 GGTCACATCAATGCAAGAGGTGG - Intergenic
1200499133 Y:3922441-3922463 GGGGTGGTCAATGCAAATTGAGG + Intergenic