ID: 920637340

View in Genome Browser
Species Human (GRCh38)
Location 1:207716845-207716867
Sequence GTTCTAAACAGAAGAAAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 655
Summary {0: 1, 1: 0, 2: 6, 3: 50, 4: 598}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920637336_920637340 27 Left 920637336 1:207716795-207716817 CCTAAATTCATATCAAATTAGAA 0: 1
1: 1
2: 9
3: 105
4: 1111
Right 920637340 1:207716845-207716867 GTTCTAAACAGAAGAAAAGAAGG 0: 1
1: 0
2: 6
3: 50
4: 598

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920637340 Original CRISPR GTTCTAAACAGAAGAAAAGA AGG Intronic
901693274 1:10988198-10988220 GTTCTTAGCAGCAGAAAAGTTGG - Intergenic
903501733 1:23804107-23804129 CTTCAAAACAAAACAAAAGAGGG - Intronic
903977373 1:27159678-27159700 AGTGTAAAAAGAAGAAAAGAGGG + Intronic
904484947 1:30818566-30818588 GTGCTAAGGAGAAGAAAAGCAGG + Intergenic
905329342 1:37181431-37181453 GTGCTAAAAAGAAAAAAAGAGGG - Intergenic
905555001 1:38875376-38875398 GTTTTAAAAAGATTAAAAGAGGG - Exonic
906015691 1:42577355-42577377 AATCAAAACAGAAGAAAACATGG - Intronic
906107233 1:43301862-43301884 CATCTAAAAAGAAAAAAAGATGG + Intronic
906216681 1:44045158-44045180 GTTCTTACCAGAAGGACAGAAGG + Intergenic
906391638 1:45422368-45422390 CTTCTAAAAAAAAGAAAACATGG - Intronic
906711806 1:47936026-47936048 GTAGTAAACAGAAGAACATATGG + Intronic
906803150 1:48755032-48755054 ATTCCACACACAAGAAAAGATGG - Intronic
907940615 1:59083851-59083873 TTGTTAAAAAGAAGAAAAGAAGG - Intergenic
908362373 1:63381640-63381662 GTTTAAAAGAAAAGAAAAGAAGG + Intronic
908663527 1:66463934-66463956 CTTCTAAAAAGAAGCAAATAAGG + Intergenic
908732971 1:67245846-67245868 GTTCCAAACAGTAGAAAAAGAGG - Intronic
908860860 1:68486740-68486762 TTTCTAAACAGAAAAAATTAAGG + Intronic
909297089 1:73964430-73964452 GTTGTCAACAGAAGACTAGATGG + Intergenic
909894279 1:81046894-81046916 TTTATAAACAGAGGAAGAGAAGG + Intergenic
910085699 1:83399651-83399673 GTTCTAAACAGAAGTTAAAGTGG + Intergenic
910087392 1:83419696-83419718 GTTTTAAAGAGAAGTAAAGCAGG - Intergenic
910748389 1:90599456-90599478 ATTCCAAACAATAGAAAAGAGGG + Intergenic
911179362 1:94847518-94847540 GTTCTATAACCAAGAAAAGAGGG + Intronic
911423035 1:97669891-97669913 GACATACACAGAAGAAAAGAGGG - Intronic
911447846 1:98021173-98021195 TTTCTTAAGAGAACAAAAGAGGG - Intergenic
911595201 1:99791848-99791870 GTTATTGACAGAAGATAAGAAGG - Intergenic
911733674 1:101314878-101314900 ATTCCAAACAGCAGGAAAGAGGG - Intergenic
911849507 1:102799362-102799384 ATTCAAATTAGAAGAAAAGAAGG + Intergenic
913348080 1:117828080-117828102 CTTCAAAGCAGAAGAAAGGAGGG + Intergenic
913380350 1:118203509-118203531 GTGTTAAAGAGAAGAAAAGAGGG - Intergenic
913720045 1:121583697-121583719 ATTCCAAACAATAGAAAAGAAGG - Intergenic
914842484 1:151259896-151259918 ATTCTAAAAAGAAGAAATGAGGG + Intronic
914857271 1:151361967-151361989 TTTTGAAAAAGAAGAAAAGAAGG + Intergenic
915057995 1:153154142-153154164 TTTCTAAAAAAAAAAAAAGATGG - Intergenic
915350417 1:155221394-155221416 AGTATAAAAAGAAGAAAAGAGGG - Intergenic
916101023 1:161393296-161393318 GTGCTAAAGAGAAATAAAGAGGG - Intergenic
917144971 1:171880383-171880405 GTTCTAAACAGAAGACATACAGG - Intronic
917298522 1:173548047-173548069 GTTATAAAAAGCAGAAAACATGG - Intronic
917313573 1:173702454-173702476 TTTATAAGGAGAAGAAAAGAGGG + Intergenic
917925993 1:179789528-179789550 GTTCTAAAATAAGGAAAAGAAGG - Intronic
918346237 1:183609718-183609740 GTTTTAAAAAGAAAAAAAAAAGG - Intergenic
918557891 1:185826594-185826616 GTTCTGAGCAGTAAAAAAGATGG + Intronic
918631669 1:186726379-186726401 ATTCCAAACAACAGAAAAGAGGG - Intergenic
919433527 1:197528098-197528120 TTCCTAAGCATAAGAAAAGATGG - Intronic
920443913 1:206001273-206001295 ATTCTAAAAAAAAAAAAAGACGG - Intronic
920627401 1:207615963-207615985 GTTCTAAGCAGACTAAAAGGAGG + Intronic
920637340 1:207716845-207716867 GTTCTAAACAGAAGAAAAGAAGG + Intronic
920927007 1:210351256-210351278 GGTCTAAATAGAACAAAAGGAGG - Intronic
921359466 1:214317278-214317300 GTCCTATAGAGATGAAAAGATGG - Intronic
921961740 1:221042518-221042540 GTTTTTAACAGCAGAAAAGTGGG - Intergenic
922245648 1:223794685-223794707 GTTTTAAACATAAGAAAAGAAGG - Intronic
922566288 1:226603850-226603872 CTTCCAAACAGGAGAGAAGAAGG - Exonic
923259057 1:232249451-232249473 GTATTAAACAGAAGAAAAACTGG - Intergenic
923339823 1:232997773-232997795 TTTCAGAGCAGAAGAAAAGAGGG - Intronic
923554149 1:234987511-234987533 GGACAAAACAGGAGAAAAGAAGG - Intergenic
923857062 1:237856612-237856634 GTTTTATAAAGAAAAAAAGAGGG + Intergenic
924066095 1:240223520-240223542 GTTCCAAACAGTAGAAAAAGAGG - Intronic
1063044215 10:2375598-2375620 GTTGAAAATAAAAGAAAAGAGGG + Intergenic
1064606961 10:17052102-17052124 CTTCTAAACAGAAGCAATGGAGG + Intronic
1064768809 10:18702392-18702414 TTCCTAAACAGAAAAAAATAAGG + Intergenic
1065675417 10:28168518-28168540 TTTCAAAACAAAAAAAAAGAAGG - Intronic
1065695542 10:28376466-28376488 GTCTCAAAAAGAAGAAAAGATGG + Intergenic
1066375265 10:34852181-34852203 TTTTTAAAAAGAAGGAAAGAAGG - Intergenic
1066394868 10:35010181-35010203 GTTGTAAACAGCAGAAAACAGGG + Exonic
1066420787 10:35262915-35262937 GTTCTAAAAGGAAAAAAAAAAGG + Intronic
1066505415 10:36037489-36037511 ATACTAAACAGGAGAAAAAAAGG + Intergenic
1066975863 10:42367434-42367456 ATTTTTAACAGGAGAAAAGAGGG + Intergenic
1067013468 10:42737022-42737044 GAGCTAAACAGAAGAAAACAGGG - Intergenic
1067310310 10:45106728-45106750 GAGCTAAACAGAAGAAAACAAGG + Intergenic
1067819502 10:49515638-49515660 GTTCGAAACAGAACAAAAGAGGG + Exonic
1067908751 10:50322529-50322551 GTTGTAAAAAGATGAGAAGAGGG + Intronic
1067970586 10:50965956-50965978 AATGTAAACAGAAGAAAGGAAGG + Intergenic
1068391597 10:56404933-56404955 GTTGGAAACACAAGAAAACAGGG - Intergenic
1068421390 10:56798843-56798865 TTTCTAAAAAGAAGAAAAAATGG - Intergenic
1068435391 10:56984306-56984328 GTTCTAAACAATAGAAAAGGAGG - Intergenic
1070423285 10:76259831-76259853 GTTCTAAAAAGAGATAAAGAAGG - Intronic
1070909856 10:80108647-80108669 GTTTTACAAAAAAGAAAAGAGGG + Intergenic
1071015287 10:80989873-80989895 GTTCTGAACATCATAAAAGAGGG - Intergenic
1071032567 10:81202831-81202853 GTTCTAGGTAGAAGAAAAAAAGG + Intergenic
1071054493 10:81493203-81493225 GTCCTAAAGAGAAAATAAGAAGG + Intergenic
1071750711 10:88472262-88472284 ATTTTAAAGAGAAGAAGAGAAGG + Intronic
1071769230 10:88706204-88706226 GTTTTAAACAGCTCAAAAGATGG - Intergenic
1072019616 10:91385065-91385087 GTTCTAATCCACAGAAAAGAAGG - Intergenic
1072454930 10:95567478-95567500 TTTAAAAAAAGAAGAAAAGAGGG + Intergenic
1073083576 10:100874473-100874495 TTTCTATACAGCAGAAAAAATGG + Intergenic
1073876919 10:107935038-107935060 GTTAAAAAAAGAATAAAAGAAGG + Intergenic
1074082621 10:110179729-110179751 ATGCAGAACAGAAGAAAAGATGG + Intergenic
1074470603 10:113723198-113723220 GTTTTAAAAAAAAAAAAAGATGG - Intronic
1075636465 10:124034275-124034297 GTTATTAAAAGAAGAAAACACGG + Intronic
1076240299 10:128900153-128900175 GAGATAAAGAGAAGAAAAGAGGG + Intergenic
1077286263 11:1767360-1767382 GTAATAAACAGAATAACAGATGG - Intergenic
1078360200 11:10662093-10662115 TTTCTAAAAAGCAGAGAAGAAGG + Intronic
1078704800 11:13732873-13732895 GTTAGAAACAAAAGAAAAAAAGG - Intergenic
1078735814 11:14019839-14019861 GTTCTAAATAGGAGAGAAGGAGG + Intronic
1080364989 11:31563700-31563722 GTTCTATACAGATGACAGGATGG - Intronic
1080650790 11:34221270-34221292 GTCCTTATCAGAAGAAGAGATGG - Intronic
1080981598 11:37413711-37413733 GTGCTAAAAAGAATAAAATAGGG - Intergenic
1081559612 11:44201271-44201293 GGTCTAAACAGAAGAATATGGGG - Intronic
1082896767 11:58200238-58200260 GATCTAACCAGAAGAAAGGCTGG + Intergenic
1083862283 11:65427749-65427771 GTTCTGAAAAGAAGAGAAGGCGG - Intergenic
1084351224 11:68601211-68601233 GTTATAAACAGACCAAAAAAAGG - Intronic
1085804922 11:79626781-79626803 GCCCTAAAAAGAAGAAAAGGAGG - Intergenic
1086412417 11:86555956-86555978 GTTTTAAAAAAAAGAAAAAATGG - Intronic
1086418276 11:86611435-86611457 GTTCTCAACACAAAAAAAGGTGG + Intronic
1086867050 11:91992246-91992268 GTTCTATGGAGAAGAAAAGTGGG - Intergenic
1087248336 11:95867371-95867393 GTTATGTACAGAAGAGAAGAGGG + Intronic
1087569508 11:99906680-99906702 ATTCCAAAAAGTAGAAAAGAGGG - Intronic
1087719463 11:101645662-101645684 GTTCCAAACAGTTGAAAAGGAGG + Intronic
1088129977 11:106476151-106476173 GTTCTTACCACAAAAAAAGAAGG - Intergenic
1088395941 11:109369699-109369721 CTTCAAAAGAGAAGAAAAGGAGG - Intergenic
1088830849 11:113535509-113535531 GTTGTAAACATACGAAAAAAAGG + Intergenic
1089166751 11:116483387-116483409 TTTCTAAAAAAAAAAAAAGAAGG + Intergenic
1089584125 11:119499145-119499167 GTTCTCCCCTGAAGAAAAGAGGG + Intergenic
1089756443 11:120691017-120691039 GTTCTAAAAAGAAGCCAAGGAGG - Intronic
1089807342 11:121103232-121103254 GTGCTACACAGAGAAAAAGAAGG - Intronic
1089904934 11:122028934-122028956 GGTCTACTCAGAAGAAAAGATGG - Intergenic
1090010736 11:123043757-123043779 TCTCTAAAAAAAAGAAAAGAGGG + Intergenic
1091192113 11:133704736-133704758 CTCCTAAAGAGCAGAAAAGAAGG + Intergenic
1091635457 12:2193531-2193553 CCTCTAAACAGAAGGAAAGGTGG - Intronic
1091772821 12:3164263-3164285 GGTCTACAAAGCAGAAAAGAAGG + Intronic
1092071612 12:5636163-5636185 GTTCTAGAGAGAGGAAATGAGGG - Intronic
1092955888 12:13549408-13549430 GTTCTGAACAGAAAAATATAAGG - Exonic
1093595562 12:20954704-20954726 ATTCTAAACAATAGAAAAGAGGG + Intergenic
1093952033 12:25173602-25173624 TATCTAACCAGAGGAAAAGAAGG + Intronic
1094095139 12:26695301-26695323 CTTCTTTACAGAAGAAAAAAGGG + Intronic
1094166472 12:27448635-27448657 GTTCTAAACAAAAGTAAACAAGG + Intergenic
1094298800 12:28937948-28937970 TTTATAAACAAAGGAAAAGAGGG - Intergenic
1095413902 12:41954395-41954417 GTACAAAACAGAAGACAAGGGGG + Intergenic
1095934450 12:47661814-47661836 ATTCTTAACATAAGAAAAGGAGG - Exonic
1096900908 12:54880971-54880993 GGTCTAAAGAGAAGAAATCATGG + Intergenic
1097687348 12:62703448-62703470 TTTCTAATGAGAAGAAAACAAGG - Intronic
1098551644 12:71768771-71768793 GTGCTATACAGAAGAAAATCAGG + Intronic
1098663158 12:73125208-73125230 GATCTCAATAGAAGAAGAGAAGG - Intergenic
1100459963 12:94789744-94789766 GTTCTCAACAGAAAAAAAAAAGG + Intergenic
1100732240 12:97484586-97484608 GATAAAAACAGAAGAAAACAAGG + Intergenic
1101273038 12:103168175-103168197 GGTGTAAGCAGAAGAAAAGTGGG - Exonic
1101644646 12:106619965-106619987 GGACAAAACAGAAGAAAAAATGG - Intronic
1101667811 12:106835751-106835773 GTTCTAGGCAGGAGAAAACATGG + Intronic
1101823872 12:108205291-108205313 GTTGTATACAGAAGAGAAAAGGG - Intronic
1102415696 12:112760730-112760752 CTTCTGAAAGGAAGAAAAGATGG + Intronic
1102949561 12:117021451-117021473 TTTCTAAACATAACAAAATATGG - Intronic
1103642463 12:122362884-122362906 GTTTTAATATGAAGAAAAGATGG + Intronic
1104098518 12:125583831-125583853 GTCCTAAACAGGAGAGGAGAGGG - Exonic
1104193810 12:126511028-126511050 ATTCAAAACAGAACAGAAGAGGG + Intergenic
1104277643 12:127344398-127344420 GTCCTAAACAGGAGAGGAGAGGG + Intergenic
1104331578 12:127852076-127852098 GAACCACACAGAAGAAAAGAAGG + Intergenic
1104554463 12:129787183-129787205 GGTCAAAACAGAATAAATGAAGG - Intronic
1104880354 12:132066754-132066776 GGTCTAAACAGTAGAAATAATGG - Exonic
1105392181 13:19990549-19990571 CTTTTAAACAGAATAACAGAAGG - Intronic
1105457626 13:20555967-20555989 CTCCTTAACAGAAGAAAATAAGG + Intergenic
1105482077 13:20787123-20787145 GTCCAAAAAAGAAGAAGAGAGGG + Intronic
1105815658 13:24033910-24033932 TTACTAAACAGAAAAGAAGAAGG + Intronic
1106434363 13:29710704-29710726 GGTGTAAATAGAAGAAAAGGTGG - Intergenic
1106991775 13:35428484-35428506 GTGCTCAACAGCAGAACAGAAGG - Intronic
1107144793 13:37049437-37049459 GTTCTAAACAAAATTAAACATGG + Intronic
1107795797 13:44050249-44050271 CTTCTAAAGAGAAAGAAAGAAGG - Intergenic
1108492817 13:50998647-50998669 CTTCTAAACAGAATAAGATATGG + Intergenic
1108762415 13:53584853-53584875 GTAATAAACAGAAGAAAAAGAGG - Intergenic
1108897147 13:55345543-55345565 GTTCTAAACAGTAGAGATCAAGG - Intergenic
1109582511 13:64361196-64361218 TTACTAAAAAGAAGAGAAGAAGG - Intergenic
1110028923 13:70580386-70580408 GTTATAAACAGACAAAATGAGGG + Intergenic
1110211009 13:72973108-72973130 ATTCTTAAGAGAAGAAAAGCTGG + Intronic
1110306344 13:73991798-73991820 GTTCAAAATGGAAGAAAAGCTGG + Intronic
1110650077 13:77933907-77933929 AAACTAAACAGAATAAAAGAAGG + Intergenic
1110719076 13:78741316-78741338 GTCCTACACATAAGAAAATATGG - Intergenic
1110772324 13:79363972-79363994 GTTATCCAAAGAAGAAAAGAGGG + Intronic
1111342416 13:86904538-86904560 GTTATAAACAGAATAAAAAATGG - Intergenic
1111625118 13:90774990-90775012 GCTCTAAAGTGAAGAAAACAGGG - Intergenic
1112018559 13:95351851-95351873 CTACTACACACAAGAAAAGAGGG + Intergenic
1112524452 13:100131118-100131140 GCTCTAAAGAGAAAAAAAAAGGG + Intronic
1112575986 13:100637298-100637320 GTTCTAACAAGGAGTAAAGAGGG - Intronic
1112629521 13:101145701-101145723 GAGGTAAACAGAAGTAAAGAGGG - Intronic
1112870690 13:103967554-103967576 ACTCTAAGCAGAAGAAAAGGTGG + Intergenic
1112889932 13:104217322-104217344 TGTCAAAACAGTAGAAAAGATGG + Intergenic
1112956741 13:105069086-105069108 TATCTCAACAGAAGAGAAGAAGG - Intergenic
1113817203 13:113181169-113181191 GTTCTAGTCAGAAGAACAAAAGG - Exonic
1114235651 14:20821271-20821293 GTTTGACACAGAAGAAAAAATGG - Intergenic
1114467528 14:22934105-22934127 GTTCTGAACATAGAAAAAGATGG + Intergenic
1115438496 14:33404485-33404507 GATCTAAAGAGAAGGAAAAAGGG - Intronic
1115902052 14:38162757-38162779 CATCCTAACAGAAGAAAAGATGG + Intergenic
1116530430 14:45966075-45966097 GGTCTGAACAGAACAAAAGATGG - Intergenic
1116799174 14:49425268-49425290 ATTCTAAATAGAAAAGAAGATGG + Intergenic
1117211768 14:53508160-53508182 GTGCAAAACAGAAAAAAAAATGG - Intergenic
1117327609 14:54683771-54683793 GCTCTACACAGAAGAACAGGAGG + Intronic
1117466165 14:55996585-55996607 GTTCTAAACAATAGAAAAAGAGG - Intergenic
1118030139 14:61811437-61811459 GTTTTTAAAAGAAGAAAAAAGGG - Intergenic
1118127038 14:62917205-62917227 ATTCAACACAGAACAAAAGAAGG - Intronic
1118158832 14:63268740-63268762 GTCTCAAACCGAAGAAAAGAAGG + Intronic
1118163711 14:63315925-63315947 TTTTTAAAAAGAAGAGAAGATGG + Intronic
1118299471 14:64602309-64602331 TTTTTAAAAAGAAGAAAATACGG - Intergenic
1118554063 14:66994063-66994085 GTTATAAAAATAAGAAAAAATGG + Intronic
1118769623 14:68933497-68933519 TTTCTACCCAGAAGAAAACATGG + Intronic
1119571270 14:75675626-75675648 TTTTTATACAGAAGAAAACATGG + Intronic
1119877131 14:78070508-78070530 TTTCTGACCACAAGAAAAGAGGG - Intergenic
1120316369 14:82898570-82898592 GTACATAACAGAATAAAAGAGGG - Intergenic
1120389463 14:83887712-83887734 ATTCTAGCCAGGAGAAAAGAAGG - Intergenic
1121097996 14:91231271-91231293 GTTCTGAAGAGAGGAAAAAAGGG + Intergenic
1121860474 14:97313085-97313107 TTTCAAAAAAGAAGAAAAGGTGG - Intergenic
1121914762 14:97827850-97827872 GTTCTAGACAGTAGAAAATGAGG - Intergenic
1122180626 14:99951598-99951620 TTTCTAAAAAGAAGCAAAGGTGG - Intergenic
1122334989 14:100967855-100967877 GTATTAAACACAATAAAAGAAGG + Intergenic
1122367981 14:101207294-101207316 CTTCTAAAAAAAAAAAAAGAGGG - Intergenic
1122944532 14:105000734-105000756 ATTCTAAACAGATGAAATGTCGG + Intronic
1124056863 15:26249152-26249174 TTTCTAAACAGATGAAAAAGAGG - Intergenic
1124201219 15:27679907-27679929 CTTATAAAAAGAAGACAAGAGGG + Intergenic
1124598867 15:31114636-31114658 CCTCTCAACAGAAGCAAAGAAGG + Intronic
1124810122 15:32928271-32928293 GTTTTAAACAGAAATAGAGAAGG + Intronic
1125192772 15:37012992-37013014 TATTTAAACAGAAAAAAAGAAGG + Intronic
1125887144 15:43237548-43237570 TTTCTAAACAAAAAAAAAAAAGG - Intronic
1126217877 15:46177381-46177403 GTTCTAAGCAGAGGAAAGGAAGG - Intergenic
1126219320 15:46194203-46194225 ATTCCAAACAAATGAAAAGAAGG - Intergenic
1126993107 15:54406591-54406613 GTTCCAAACTGATGAAAATAAGG - Intronic
1127313543 15:57773467-57773489 CCTCTAAACATAAAAAAAGATGG - Intronic
1127567523 15:60206698-60206720 GTTCTAAAAAGCAGAAATTAGGG + Intergenic
1127923125 15:63509950-63509972 GGTCTAAGCAGAAGAAATGATGG + Intronic
1128947115 15:71832997-71833019 CTTCCAAACAAAAGAAAAAATGG + Intronic
1129071005 15:72951571-72951593 TTTCTTAAGAGAAAAAAAGAAGG + Intergenic
1130371275 15:83286502-83286524 CTTTTATAGAGAAGAAAAGAGGG - Intergenic
1130795541 15:87204928-87204950 GTTATTAACAGAAGAATAAATGG - Intergenic
1131126014 15:89857644-89857666 GCTCTAATAAGAAGAAAACATGG - Intronic
1131965365 15:97836308-97836330 GATCAAAACAGGAGCAAAGAAGG - Intergenic
1133595320 16:7285514-7285536 GTTGTAAAAAGAAAAACAGAAGG - Intronic
1133822848 16:9252308-9252330 GCTCAATACACAAGAAAAGAAGG + Intergenic
1134639966 16:15822375-15822397 GTTCTAAATAGAAGGTGAGAAGG + Intronic
1135965616 16:27032649-27032671 GTCCTAAGCAGATGAAAGGATGG + Intergenic
1136089966 16:27911640-27911662 GTTCCAAACAGCAGAACAGCAGG - Intronic
1137296700 16:47100908-47100930 ATTCCAAACAACAGAAAAGAGGG + Intronic
1137336099 16:47550752-47550774 ATTCCAAACAACAGAAAAGAGGG - Intronic
1137913812 16:52406273-52406295 ATATTAAAAAGAAGAAAAGAAGG + Intergenic
1137989481 16:53139077-53139099 ATTCTTAAGAGAAGAAAACATGG - Intronic
1138108570 16:54305319-54305341 GTGCTAACCAGAAGGAAGGAAGG + Intergenic
1138887236 16:61094302-61094324 GTTCCAAACAGTAGAAAAAGAGG + Intergenic
1139165598 16:64561568-64561590 GTTCCAAACTGAGAAAAAGAAGG - Intergenic
1139233028 16:65305056-65305078 GTTTTAAACAAAAGAAAGGATGG - Intergenic
1139766988 16:69238862-69238884 GTTGAAAATAGAATAAAAGAAGG - Intronic
1140139553 16:72242440-72242462 CTTCTCAGGAGAAGAAAAGATGG + Intergenic
1140142941 16:72276410-72276432 GTTGTACACAGAGGAAAAGCTGG - Intergenic
1140549842 16:75853880-75853902 GTTTTTAAAAGAAAAAAAGAAGG - Intergenic
1140816950 16:78630001-78630023 GTGCTAAGGAGAAAAAAAGAAGG - Intronic
1140860153 16:79011030-79011052 TTTATATACAGAAGTAAAGATGG - Intronic
1141024871 16:80537076-80537098 GTTCAAAGAAGAAGAAAGGAAGG - Intergenic
1141690505 16:85593846-85593868 GTTCTGGCCAGAAGAAAAAACGG - Intergenic
1141729836 16:85814544-85814566 GCTCAAAAAAAAAGAAAAGAAGG - Intergenic
1141827474 16:86491086-86491108 TTTCCAAACAAAAGAAAGGACGG - Intergenic
1142392445 16:89810721-89810743 ATTCTTGACAGAAGGAAAGACGG + Exonic
1142921317 17:3189690-3189712 GTGCTAGACAGCAGAGAAGAGGG + Intergenic
1143070459 17:4287736-4287758 GTTCTAAGAATAAGAAAAAAAGG + Intronic
1143558224 17:7675916-7675938 GTTCCAAACAAAAGAAATGCAGG + Intronic
1146542429 17:33708962-33708984 TTTCTAAAATGAGGAAAAGAAGG + Intronic
1146689534 17:34863673-34863695 TTTCTAAACAAGAGAACAGAGGG + Intergenic
1147400354 17:40177308-40177330 GTTCTAAGCAGAAGAAATTAAGG - Intronic
1148066683 17:44876152-44876174 GTTCAAAGCAGAACCAAAGAAGG + Intronic
1148209350 17:45798851-45798873 GTTGTACAGAGAAGAAAAAATGG - Intronic
1148593190 17:48831610-48831632 GTTCTAGGCAGGAGGAAAGACGG + Intronic
1149193780 17:54095113-54095135 GTTCTAAACATAAGAAAAATGGG - Intergenic
1149551588 17:57544434-57544456 CTTATAAAGAAAAGAAAAGAGGG - Intronic
1150171349 17:62998958-62998980 ATTGTAAACAGAAGAAAGCAGGG + Intergenic
1151671963 17:75575810-75575832 GTTCCAGACAGAGGACAAGAGGG + Intergenic
1153011529 18:544002-544024 GTTCCAAAAAGAATAAAAGGAGG - Intergenic
1153356285 18:4139864-4139886 GCTCTAAAAAGAAATAAAGAAGG - Intronic
1153439896 18:5104576-5104598 CTTCAAAGGAGAAGAAAAGATGG - Intergenic
1153918796 18:9770224-9770246 ATTCCAAACAATAGAAAAGAGGG - Intronic
1154464481 18:14630649-14630671 GTCCCAAACAGAAGGCAAGAAGG - Intergenic
1155680428 18:28480225-28480247 GTTATGAAAAGAAAAAAAGAAGG + Intergenic
1156014228 18:32529290-32529312 GTTCTAACCAGAAGTAATCATGG - Intergenic
1156102239 18:33610446-33610468 GTTCTAGACAGTAGAAGATAAGG + Intronic
1156180132 18:34593777-34593799 GTGCTTAAGAGAAGAATAGAGGG - Intronic
1156839005 18:41589277-41589299 CTCACAAACAGAAGAAAAGACGG + Intergenic
1157062084 18:44303453-44303475 GTTCTAATCAATAGAAAAGGAGG + Intergenic
1157630906 18:49094170-49094192 TCACTAAACTGAAGAAAAGAGGG + Intronic
1158389926 18:57036425-57036447 GTTCCAAACTGAAGCAAAGAGGG - Exonic
1158712909 18:59853060-59853082 ATTCAAGACAGAATAAAAGATGG - Intergenic
1159123800 18:64199912-64199934 GTTGGAGACAGAAAAAAAGAGGG + Intergenic
1159557352 18:69959245-69959267 GTTCTAACCAGCAGAACAAATGG + Intronic
1160177258 18:76605566-76605588 ATGATAAACAGAAGAATAGATGG - Intergenic
1161418614 19:4162680-4162702 CATCTTAAAAGAAGAAAAGATGG + Intronic
1162155693 19:8676867-8676889 GTTCATGCCAGAAGAAAAGAAGG + Intergenic
1162342335 19:10098999-10099021 GATCTAAGCAGAAGAGCAGACGG - Intronic
1163823159 19:19507803-19507825 GTTCGAGACAGCAGAAATGAAGG - Exonic
1164123267 19:22286929-22286951 ATTTTTAACAGAAGAAAAGAGGG - Intronic
1164557532 19:29265379-29265401 GTCCCAAAGAAAAGAAAAGAAGG + Intergenic
1165936671 19:39393394-39393416 GTTCAAAAAAAAAGAAAAGGAGG - Intronic
1166362846 19:42262072-42262094 AGTCTAGACAGGAGAAAAGAGGG - Intergenic
1166496626 19:43307568-43307590 CTTATAAATAGAAGAAAACATGG - Intergenic
1166879867 19:45922193-45922215 GTGCTATACAGAAGAAATAAAGG + Intergenic
926372479 2:12193931-12193953 ATTCTAAAAAAAACAAAAGATGG + Intergenic
926687125 2:15706682-15706704 GTTCTAAAGACAAGAGAAGATGG + Intronic
926987009 2:18635661-18635683 ATTCTAAAAAAATGAAAAGAAGG - Intergenic
927069863 2:19516855-19516877 TTTCTAAGCAGAAGAAATTAAGG - Intergenic
927145122 2:20159555-20159577 GTTATAAGCACATGAAAAGATGG - Intergenic
927383952 2:22511454-22511476 GTTCTTATCAGAAAAAGAGAGGG - Intergenic
927871671 2:26628016-26628038 GTTCCAAACAGAAACGAAGATGG + Intronic
927931490 2:27048472-27048494 GTTCGAAAGAATAGAAAAGAAGG - Intronic
928006439 2:27566428-27566450 GTTTTAAAAAGAAGAAAGGAAGG + Intronic
928031704 2:27785434-27785456 GTAATAAACACACGAAAAGATGG + Intronic
928125247 2:28611092-28611114 GTTGGAAAAAAAAGAAAAGAAGG + Intronic
928127663 2:28627509-28627531 GTTTTAAAAAGAAGGAAAGGGGG + Intronic
929312280 2:40439125-40439147 GATCTTAATAGGAGAAAAGAGGG + Intronic
929406352 2:41647069-41647091 GTTCTAAGCAATAGAAAAAAAGG - Intergenic
930856027 2:56019029-56019051 ATTATAAGCAGAAGAGAAGAAGG + Intergenic
930925412 2:56811971-56811993 GTAATAAAAGGAAGAAAAGAAGG - Intergenic
932203032 2:69849725-69849747 TTTCTAAACAGAGGAAAGGTAGG + Exonic
932882645 2:75518197-75518219 TTCCCAAACAGAAGAGAAGAAGG - Exonic
933284314 2:80368507-80368529 TTTCTAAACTGAAGCAAAAATGG - Intronic
935237005 2:101147996-101148018 GCTCTAACCTGAGGAAAAGATGG + Intronic
935391047 2:102553042-102553064 CTTCTAATGAGAAGAAAACAAGG - Intergenic
935951605 2:108334873-108334895 GTAGTAAACGGAAGGAAAGATGG - Intergenic
938389571 2:130894204-130894226 GAACTAAACAGAAGCACAGAAGG + Intronic
939400412 2:141685119-141685141 ATTTTAAAAAGAAGAAAAGGAGG - Intronic
939453799 2:142406830-142406852 GTGCTAAACAGGAGAATTGATGG + Intergenic
939848467 2:147276268-147276290 GTTCTAAAGAAAAGTAAAGTTGG - Intergenic
940262503 2:151796312-151796334 ATAGTAAACAGAAGAAAAAAGGG - Intronic
940470451 2:154091597-154091619 GTTCTAAACACTAGAAATGAAGG + Intronic
941390528 2:164907907-164907929 GTTTTACACAGAAGACAAGATGG + Intronic
941861830 2:170290433-170290455 GTTGTAAAAAGAAACAAAGAAGG - Intronic
942801179 2:179878096-179878118 GTTATAAACAGAACTAAATAAGG - Intergenic
943473735 2:188328907-188328929 CTTCTAAAAAGTGGAAAAGAAGG - Intronic
943645224 2:190402949-190402971 TATGTAAACAGAAGGAAAGAAGG - Intergenic
943795352 2:191986328-191986350 GCTTTGAACAGAAGAAAAGCAGG + Intronic
944108538 2:196105988-196106010 GTTCTGAAAAGAAGAAAATCTGG - Intergenic
944273552 2:197809476-197809498 GTTCTGAACTGAAGGAAAGAAGG - Intronic
944375837 2:199041028-199041050 GTTCTATAGAAAAAAAAAGATGG + Intergenic
944828217 2:203506225-203506247 GTTTCAAACAGACAAAAAGATGG + Intronic
944980340 2:205110566-205110588 GTTATACATAGAAGAAAAGTGGG - Intronic
945688192 2:212998241-212998263 GTGCCAAACAGGAGAAAAGTAGG + Intergenic
945818934 2:214639185-214639207 GTGCCCAAGAGAAGAAAAGATGG + Intergenic
946048194 2:216838510-216838532 GCTCAGAAAAGAAGAAAAGAGGG + Intergenic
947006428 2:225516537-225516559 GTTCTGAAGAGAAAAAAAAAAGG - Intronic
947365006 2:229384866-229384888 ATTCCAAACAATAGAAAAGAGGG + Intronic
947663993 2:231891579-231891601 AATCTAAACTGAGGAAAAGAAGG - Intergenic
948404448 2:237706602-237706624 GGTCTACACAAAAGCAAAGAGGG - Intronic
948538050 2:238661888-238661910 GTTCTAAAGACTAGAAAAGGAGG - Intergenic
1169325787 20:4674768-4674790 GTTCTTTAGAGAAAAAAAGATGG + Intergenic
1169890718 20:10449127-10449149 GTCATAAACCAAAGAAAAGATGG + Intronic
1169997870 20:11578837-11578859 CAGCTGAACAGAAGAAAAGAGGG - Intergenic
1170209250 20:13831667-13831689 GTTCTTAGCAGGAAAAAAGAAGG + Intergenic
1171106831 20:22441520-22441542 GGGCTAAATAGAAGAACAGATGG + Intergenic
1171838568 20:30180763-30180785 GTTCTAGATACAAGGAAAGAGGG - Intergenic
1172296236 20:33813009-33813031 GTACTAAACACACAAAAAGATGG + Intronic
1172984378 20:38971515-38971537 GGTCTAAACAGAAGTGAACATGG - Intronic
1173981426 20:47226992-47227014 GTTCTGAACAGAGGAAAGGGGGG + Intronic
1174391768 20:50222175-50222197 GTTCTAAACAGAGGAAAGATGGG - Intergenic
1176810055 21:13527740-13527762 GTCCCAAACAGAAGGCAAGAAGG + Intergenic
1177099483 21:16882421-16882443 ATTCAAAACAGTTGAAAAGAAGG + Intergenic
1177136749 21:17312510-17312532 GTTCCAAACAATAGAAAAAAGGG + Intergenic
1177221970 21:18206728-18206750 TTACTAAAAAGAAGTAAAGAAGG - Intronic
1177356415 21:20014109-20014131 CTCCTAAGCAGAAAAAAAGATGG + Intergenic
1177574926 21:22941131-22941153 TTTCCAAAGAGAAAAAAAGAGGG - Intergenic
1178079175 21:29045366-29045388 CTTCCAAATAGAGGAAAAGAAGG - Intronic
1179082324 21:38183063-38183085 ATTCTCAATAGAATAAAAGAAGG - Intronic
1179558504 21:42195772-42195794 GCTAAAAACAGAAGAAAAGATGG + Intergenic
1181793439 22:25285409-25285431 TTTCAAAACAGTAGAGAAGATGG + Intergenic
1181833419 22:25581270-25581292 TTTCAAAACAGTAGAGAAGATGG + Intronic
1182721364 22:32403524-32403546 GTTCTCACCAGAAAAACAGAAGG - Intronic
1183695744 22:39421072-39421094 GTTTAAAAAAAAAGAAAAGAAGG - Intronic
1183791654 22:40076041-40076063 GATCTAAACAAAAGAATAAAGGG - Intronic
1184296954 22:43530962-43530984 TTTCTAGACACAAGACAAGAAGG + Exonic
1184442766 22:44528397-44528419 GTTCTGAAGACAATAAAAGATGG + Intergenic
1184574462 22:45351138-45351160 GTTCTATAGAGAAAAAAAGCAGG - Intronic
949235205 3:1800786-1800808 ATTCCAAGCAGAACAAAAGAAGG - Intergenic
949444700 3:4121514-4121536 GTTCTTGGCAGAAAAAAAGAAGG - Intronic
950152843 3:10701641-10701663 GTTGCAAACAAAAGAAATGATGG - Intronic
950262086 3:11550220-11550242 GTACTAACCAGAAAAAAAAATGG - Intronic
950284246 3:11732343-11732365 GCTCTAGACAGAAGGAAGGAAGG - Intergenic
951367629 3:21803399-21803421 CTCCTATACAGAAGAAAACATGG - Intronic
951368867 3:21818368-21818390 GTTGCAAACAGGGGAAAAGATGG - Intronic
951492499 3:23287459-23287481 GTTCTAAAAAAGAGAAGAGAAGG - Intronic
951831593 3:26934920-26934942 GTTGTAAGCAGCAGAAGAGATGG - Intergenic
951887731 3:27540251-27540273 ATTAAAAAAAGAAGAAAAGATGG + Intergenic
951919455 3:27838402-27838424 ATTCAAAACAGAAGAAAACGTGG - Intergenic
951938893 3:28055331-28055353 GTTCTAACTAGGAGCAAAGATGG + Intergenic
952445602 3:33377987-33378009 CTTCTTAACAGAAGAGAACAAGG + Intronic
955100326 3:55842877-55842899 GTTCTATGCAGAAGGAAAGCAGG + Intronic
955683943 3:61531166-61531188 GTACTAAACATAGAAAAAGATGG + Intergenic
957262818 3:77922556-77922578 GGTATTAATAGAAGAAAAGAAGG + Intergenic
957362886 3:79182245-79182267 ACACTAAAGAGAAGAAAAGATGG - Intronic
957876429 3:86152892-86152914 TTTCTAAACTCAAGAAAAAAGGG + Intergenic
958025649 3:88045831-88045853 GATTTAAGCAGAAGGAAAGAAGG + Intergenic
958029820 3:88095269-88095291 GTGCTCCACAGGAGAAAAGATGG - Intronic
958685170 3:97384273-97384295 GTTCTTAGAAGAAGAAATGAAGG + Intronic
958945946 3:100362171-100362193 GTTTTAGACAGAAGAGGAGATGG - Intergenic
959315691 3:104803694-104803716 AATGTAAACAAAAGAAAAGAGGG - Intergenic
959479729 3:106856677-106856699 GTTCCAAACAACAGAAAAGAGGG + Intergenic
959766035 3:110029626-110029648 GTTATAAAGAAAAGAAAAGCAGG - Intergenic
959768933 3:110069393-110069415 TTTCTAAAGCGAAGGAAAGAAGG + Intergenic
959871946 3:111338658-111338680 CTTATAAACAGAAGGAAAGAAGG + Intronic
959957919 3:112259907-112259929 CTTCAAAACATAAGAATAGAAGG - Intronic
960008653 3:112809044-112809066 GTTCTAAACAGCTGAAAAGATGG - Intronic
960256304 3:115515103-115515125 GTCATAAATAGTAGAAAAGATGG + Intergenic
961400051 3:126634249-126634271 GTTCTGAAAAGAAGAAAACTGGG + Intronic
961517851 3:127449561-127449583 GTTTTAAACAGAACTAGAGAGGG - Intergenic
961872015 3:129995545-129995567 GTTAAAAAAAGAAGGAAAGAGGG - Intergenic
962158896 3:132978294-132978316 GTTGTAAAGATTAGAAAAGATGG + Intergenic
962509799 3:136086642-136086664 GTACTAGATAGAAAAAAAGAGGG - Intronic
962917116 3:139914301-139914323 GCCATAAACAGAATAAAAGATGG - Intergenic
962950919 3:140217861-140217883 GTTCTCTACAGCAGAAAAGAAGG + Intronic
963099543 3:141586418-141586440 GTACTATACAGAACAAAAAAGGG - Intronic
963148734 3:142021627-142021649 GTTCTAGATACAAGAAAAGGAGG - Intronic
964962907 3:162450196-162450218 ATTCTAAACAATAGAAAAAAAGG - Intergenic
965722729 3:171679461-171679483 TTTGTTAAAAGAAGAAAAGAGGG + Intronic
965770037 3:172172315-172172337 GATTTAAAAAGAAGAAAAAAGGG + Intronic
966193590 3:177292575-177292597 GTTCAAAACATGAGAAAAAAGGG - Intergenic
966704601 3:182897636-182897658 TTTCTACACAGAAAAAAACAGGG - Intronic
967657721 3:192071798-192071820 AATCTAAACAGAATAAGAGAAGG + Intergenic
967674794 3:192284156-192284178 GTTCTAACTAGTAGAAAATAGGG - Intronic
967773848 3:193363957-193363979 GATCAAAACAGGAGAAAATACGG - Intronic
967837109 3:193974128-193974150 TTTCTAAACTGAAGAAAAGGGGG + Intergenic
969069446 4:4523316-4523338 TTTCAAGTCAGAAGAAAAGAGGG - Intronic
970197520 4:13566814-13566836 GTTCTAACTAGAAGAAATGCTGG - Intergenic
970886340 4:20991570-20991592 GATCTAAAATGAATAAAAGAGGG + Intronic
971065126 4:23022869-23022891 GTACTAAATAGAAGAAAATTTGG - Intergenic
971228431 4:24777078-24777100 TTATAAAACAGAAGAAAAGAAGG - Intergenic
971415781 4:26427486-26427508 ATTATAAAGAGAGGAAAAGAGGG + Intronic
971785735 4:31099965-31099987 ATGCTGAACAGAAGGAAAGAAGG + Intronic
971794745 4:31212555-31212577 GTGAGAAAGAGAAGAAAAGAAGG - Intergenic
972066839 4:34957397-34957419 GTTCTAAAGAGATGGAAACAAGG + Intergenic
972116888 4:35647240-35647262 GTACAATACAGAATAAAAGATGG - Intergenic
972129266 4:35809447-35809469 GAACTAAACAGAAAAAAAGAAGG + Intergenic
972893384 4:43587776-43587798 ATTTGAAACAGAACAAAAGAGGG - Intergenic
973182148 4:47282819-47282841 GTTGCAAACAGAACAAAGGAAGG + Intronic
974230385 4:59105688-59105710 GTTCAAAAGTGAAGGAAAGAGGG + Intergenic
974243940 4:59289667-59289689 GTTCAAAAAATAAAAAAAGAGGG - Intergenic
974414074 4:61581901-61581923 GTAATAAAGATAAGAAAAGATGG - Intronic
974549570 4:63353623-63353645 GTTACAAACAAAAGATAAGATGG + Intergenic
975242212 4:72073927-72073949 TAGCTAAACAGAAAAAAAGATGG + Intronic
975683773 4:76899914-76899936 GTTTTAAAAAGTAGCAAAGAGGG - Intergenic
975696578 4:77019879-77019901 ATTCAAAACAGAGGAAAAGGAGG - Intronic
976092129 4:81470175-81470197 TTTCATAACAGAAAAAAAGAAGG - Intronic
976632857 4:87256892-87256914 GTTTTAAAGAAAAGAAAACAGGG - Intergenic
977005410 4:91563129-91563151 GTTCCAAAATAAAGAAAAGAAGG + Intronic
977165316 4:93687424-93687446 GTTGTCAGCAGAAGAGAAGAAGG + Intronic
977202742 4:94136237-94136259 GTCATAAACAGGAGAAAATATGG + Intergenic
977236585 4:94514576-94514598 GTTCTGAAAAGTAAAAAAGAAGG - Intronic
977427149 4:96881731-96881753 GTTATAAACAGAAAATAATAGGG + Intergenic
977593394 4:98851355-98851377 GCTCTAAGCAGAGGAAAAAATGG + Intergenic
977933755 4:102777497-102777519 CTTCTTAAAAAAAGAAAAGAAGG - Intergenic
978620954 4:110633951-110633973 GCTTTAAAGACAAGAAAAGAAGG + Intronic
979429568 4:120612382-120612404 GTTCAAAGCAGAAAAAAAGATGG - Intergenic
979630535 4:122897383-122897405 GTCATAAACAGAAGAATAGGTGG + Exonic
980295263 4:130906543-130906565 GTTATATACAGAAGAAATGAGGG + Intergenic
980606408 4:135096694-135096716 GTTTTAAACAGTAACAAAGAAGG - Intergenic
980749981 4:137076322-137076344 GTTCCAGGCAGCAGAAAAGAGGG - Intergenic
981578468 4:146229005-146229027 GTTCTAAAGGGAAGAATGGAAGG - Exonic
981892889 4:149760001-149760023 GTTCTAGACAGAAGGAAGGAAGG + Intergenic
982413541 4:155106222-155106244 GTCCTAATCAGAAGATCAGATGG + Intergenic
982949588 4:161674366-161674388 GTTATGTACAGAATAAAAGACGG + Intronic
983269318 4:165542957-165542979 ATTCAAAATAGAAGAAAAAAAGG - Intergenic
983286635 4:165748381-165748403 TTTCTAAAGAGAAAAATAGAAGG + Intergenic
983636580 4:169903294-169903316 GATAGAAAGAGAAGAAAAGAGGG - Intergenic
983867632 4:172787863-172787885 TTTCAAAACAGAAGTAAAGGTGG + Intronic
984365320 4:178792046-178792068 TTTCTACATAGAAGAAAACAAGG - Intergenic
984489616 4:180416449-180416471 GTTTTAAAAAAAAGAAAAAAAGG + Intergenic
984694193 4:182763258-182763280 GTTTCAAACTCAAGAAAAGATGG + Intronic
985131975 4:186747869-186747891 ATTCAAAACAGAAGAAATCATGG - Intergenic
985439639 4:189971213-189971235 GTTCAAGACAGAAGAAGAGTGGG - Intergenic
986896778 5:12380781-12380803 TATATAAACAGAAGAAAACAAGG - Intergenic
987531357 5:19125119-19125141 GTTGAAAACTGAAGAAAAGCTGG - Intergenic
987591133 5:19928386-19928408 TTGCTAAACAAAATAAAAGATGG + Intronic
987713057 5:21528989-21529011 TTTCAAAAGAGAAGAGAAGAGGG - Intergenic
988181121 5:27795724-27795746 ATTTTAAAAAGAAGAAAAGAAGG - Intergenic
988460646 5:31434009-31434031 GGTCTATACAGAAGAAAGGTGGG + Intronic
988520184 5:31938710-31938732 GTTCTAAATATGAGAAAACATGG - Intronic
990400938 5:55436723-55436745 TTTTTAAACAAAAGAAAAAATGG - Intronic
991397443 5:66219434-66219456 ATTCCAAACAATAGAAAAGAGGG - Intergenic
991587197 5:68213630-68213652 GTTCTAGACAGAAGGAAGGGAGG + Intergenic
991644035 5:68782688-68782710 GTTGTAGACAGCAGCAAAGAGGG + Intergenic
991658637 5:68928268-68928290 TTTCTAAATAGAAAAAAAGCTGG + Intergenic
992141176 5:73798688-73798710 GAAGGAAACAGAAGAAAAGAAGG + Intronic
992311277 5:75501625-75501647 ATTTTAAACAGAGGATAAGAAGG + Intronic
992340692 5:75820249-75820271 ATTCCAAACAAAAGAAAAAAAGG + Intergenic
992625378 5:78632013-78632035 GACCTAAACAGAAGAGAAAAGGG + Intronic
993185473 5:84613193-84613215 GTTTTAAAGAGAAGAAAAAATGG + Intergenic
993242989 5:85414936-85414958 GCAGTAAACAGAAGGAAAGAAGG - Intergenic
993359106 5:86951227-86951249 GCTGTAAACAGAGGAAAAAATGG + Intergenic
993392258 5:87334336-87334358 GGTCTGAACAGAACAAAAAATGG - Intronic
993481859 5:88433690-88433712 GTTCAACAGAGAAGAAAAGGAGG - Intergenic
994563890 5:101415018-101415040 GTTCAACACATAAGACAAGAAGG - Intergenic
994835846 5:104851138-104851160 GTTCCAAACAACAGAAAAAAGGG - Intergenic
995524572 5:113040207-113040229 GTTCCAAACAGAAGAAAGTTAGG + Intronic
995764442 5:115600820-115600842 GTTATAAAAAGAAGCAAAGTAGG + Intronic
996054954 5:118972580-118972602 ATTCCAAACAGTTGAAAAGAAGG + Intronic
996159100 5:120140272-120140294 TTTTTAAATAAAAGAAAAGAGGG - Intergenic
996546790 5:124687855-124687877 GTTATATACAGAAGAAGACAAGG + Intronic
996594701 5:125186834-125186856 GTTGTAAACAGAAGAAGAAATGG + Intergenic
997903994 5:137796127-137796149 GTTATTGACAGAAGTAAAGATGG + Intergenic
1000653857 5:163852185-163852207 ATTCCAAACAATAGAAAAGAGGG - Intergenic
1001350418 5:170957609-170957631 GCTCTAAACAGAATATAAAAAGG - Intronic
1001467713 5:171983222-171983244 GTTCTAGACAGATGAACAGGTGG + Intronic
1002079882 5:176731380-176731402 GTTACAAACAGAGAAAAAGAAGG + Intergenic
1002306207 5:178285518-178285540 AGTCTCAATAGAAGAAAAGATGG - Intronic
1002711386 5:181197286-181197308 ATTATAAACAGAAGATGAGAGGG + Intronic
1003164637 6:3665598-3665620 AGTTTAAACAAAAGAAAAGAGGG + Intergenic
1003614026 6:7638945-7638967 GTTGTAAACACAAGCAATGAAGG - Intergenic
1004099576 6:12595028-12595050 GCTCAAAGCAGAAGAAAAGTTGG - Intergenic
1005384439 6:25272185-25272207 GTTCTAAAAAGCAGCAAAAAAGG - Intergenic
1005777034 6:29145262-29145284 GTTCCAAAGAGAAGAAAACATGG + Intergenic
1006883363 6:37358699-37358721 ATTTTAAAGAGAAGAGAAGAGGG + Intronic
1007112915 6:39323641-39323663 GTTCTTAATAGAAGGAAACAGGG - Intergenic
1007289168 6:40772144-40772166 ATTGTAAAGGGAAGAAAAGAAGG + Intergenic
1007469418 6:42078818-42078840 GGTTTAAACAGTAGGAAAGAGGG + Exonic
1007515544 6:42407709-42407731 GTTTTTAAAAGAAGAAAGGAGGG - Intronic
1008186703 6:48401305-48401327 GTTCTGAAAAGAAAAAAAGGTGG + Intergenic
1008208180 6:48687886-48687908 GTTCTTATAAGAAGGAAAGAAGG - Intergenic
1009280263 6:61741233-61741255 GTTCTAAAAAGAAAAAAAAATGG + Intronic
1009405560 6:63307849-63307871 ATTCTAAACACAATAAAATAGGG + Intronic
1009561373 6:65248799-65248821 TATCTAAACATAAGAAAACATGG + Intronic
1009810511 6:68657420-68657442 TTTTTAAACAGACGAAAATATGG + Intronic
1009849170 6:69173396-69173418 TTTTTAAACAGAAGAAAAAGTGG + Intronic
1009952001 6:70408565-70408587 GTTTAAAAAAGAATAAAAGAGGG + Intergenic
1010804880 6:80223928-80223950 TTTCTGACCAGAAGAATAGATGG + Intronic
1011192857 6:84751099-84751121 TTTCTAAGCAGAAGAAAAATTGG + Intronic
1011573319 6:88763923-88763945 GTTGAAATCAGAACAAAAGATGG + Intronic
1012392954 6:98763746-98763768 ATTCCAAACAATAGAAAAGAAGG + Intergenic
1012410962 6:98956619-98956641 TGTATAACCAGAAGAAAAGAAGG - Intergenic
1012616108 6:101282099-101282121 TTCATAAACATAAGAAAAGATGG + Intergenic
1012844126 6:104368225-104368247 GTTCTTACCACAATAAAAGATGG - Intergenic
1012929467 6:105301920-105301942 GTTCTGAATACAAGGAAAGAAGG + Intronic
1013148545 6:107420382-107420404 GTTTGAAAAAGAAGAAAAGTAGG + Intronic
1013438051 6:110133379-110133401 TATCTACCCAGAAGAAAAGAAGG - Intronic
1013658569 6:112271042-112271064 ATTCAAAACAGATGAACAGATGG - Intergenic
1013707769 6:112859033-112859055 GCTAGAAACAAAAGAAAAGAAGG + Intergenic
1014079685 6:117271911-117271933 GCCCTAAAAATAAGAAAAGAAGG - Intronic
1014652648 6:124059486-124059508 GTTCTAAAGAGATAATAAGATGG - Intronic
1014699139 6:124661704-124661726 ATGCTAACCAGAAGAAAATATGG - Intronic
1014762711 6:125375211-125375233 GGAATAAACAGAGGAAAAGAAGG - Intergenic
1014836201 6:126163588-126163610 ATTCCAAACAATAGAAAAGAGGG - Intergenic
1014920205 6:127205545-127205567 GTTTCAAACAGTAGAAAACAAGG - Intergenic
1015032191 6:128608327-128608349 TTTGGAAACAGAAGAAAAGGGGG + Intergenic
1015092536 6:129375851-129375873 GTTCTACACAGGAGAAATAATGG - Intronic
1015094544 6:129399230-129399252 GTTCTAAGAAGAACAAAATAAGG + Intronic
1015156977 6:130107703-130107725 GTACTAAACAGAAAAAAGGTTGG - Intronic
1015315865 6:131815387-131815409 ATTCAAGGCAGAAGAAAAGAAGG - Intronic
1015695071 6:135970885-135970907 GTAGTAAACAGAAGAAAAGAGGG + Intronic
1015940969 6:138451420-138451442 GTACTAAAGAGAAAAAAAGCAGG - Intronic
1017188682 6:151628525-151628547 GTCCTAAAAAGAGGAAAATATGG - Intergenic
1017262010 6:152398267-152398289 GTTTTAAAAAGAAGAAGACATGG - Intronic
1017312755 6:152992972-152992994 AATCTATACAGAAGAAAAGTTGG + Exonic
1018304481 6:162440674-162440696 GTCCTGAAGAGAAGAAGAGATGG - Intronic
1018612188 6:165657008-165657030 AATCTAAACAGAACAAAACATGG - Intronic
1019719887 7:2562458-2562480 CTTCTAAAAAACAGAAAAGAAGG - Intronic
1019919346 7:4153134-4153156 GTTCCAAACAGAAGACAGAAAGG + Intronic
1019999801 7:4749289-4749311 GTGCAAAACAGAAGAGAAGAGGG - Intronic
1020327395 7:6985715-6985737 GTACTCGACAGAAGAAAAGTAGG - Intergenic
1020406473 7:7840955-7840977 GTTTTTGACATAAGAAAAGAAGG - Intronic
1020619454 7:10500371-10500393 ATTCTAAACAACTGAAAAGAGGG + Intergenic
1021349998 7:19580636-19580658 GGTCATCACAGAAGAAAAGATGG - Intergenic
1021750869 7:23798205-23798227 GTTCCAAACAGTAGAAAAAGAGG + Intronic
1022141001 7:27492634-27492656 GTTGGACACAGAAGAAACGAGGG - Intergenic
1022193119 7:28036659-28036681 GTGCCAAACAGAGGAAAGGAGGG + Intronic
1022941792 7:35248973-35248995 GCTTTAAACAAAACAAAAGAGGG - Intronic
1022982474 7:35617530-35617552 GTTCCCAACAGAAGAGAAGGTGG + Intergenic
1024133789 7:46385966-46385988 GTTTTAAAGATAAGACAAGAAGG + Intergenic
1024341117 7:48261466-48261488 GTTCTAGAAAGAAAAAAACAAGG - Intronic
1024475866 7:49809780-49809802 GATCTCAACAGATGCAAAGAAGG + Intronic
1024960530 7:54970008-54970030 AATCTAATCAGAAAAAAAGACGG - Intergenic
1026026724 7:66751333-66751355 TTTAAAAACAGAAAAAAAGAGGG - Intronic
1026189773 7:68114551-68114573 ATCATAAACAAAAGAAAAGACGG - Intergenic
1026424257 7:70274195-70274217 GATATTAAAAGAAGAAAAGAGGG - Intronic
1027302575 7:76856112-76856134 GTTCTAAACAGAAGTTAAAGTGG + Intergenic
1027304273 7:76876177-76876199 GTTTTAAAGAGAAGTAAAGCAGG - Intergenic
1028570784 7:92284545-92284567 GTTCTTAAAAGAATAAAAGGGGG + Intronic
1030109700 7:106016473-106016495 GTTGTAAAGGGCAGAAAAGAAGG - Intronic
1030252109 7:107458399-107458421 GTAAAAAACAGCAGAAAAGATGG + Intronic
1030320188 7:108158663-108158685 CTTCTAAAAAGAAAAAAACAAGG + Intronic
1030855151 7:114546564-114546586 CTTCTAAACAGATGAGAAGCAGG - Intronic
1031839678 7:126722694-126722716 GCTCAAAACAGAAGATGAGAAGG - Intronic
1031926748 7:127646247-127646269 GTTCTTAAAAGAAAAAAAAAAGG + Intergenic
1031960365 7:127983958-127983980 GGTGTAAACACAAGAAAGGAGGG - Intronic
1032293512 7:130612963-130612985 GTTGTACACATAATAAAAGAGGG - Intronic
1033479438 7:141725003-141725025 CTTCAAAACAGAAGACAGGAAGG - Intronic
1033922492 7:146411475-146411497 GTTCTCACCACAAGAAAATATGG + Intronic
1036762767 8:11522056-11522078 GGCTTAAACAGAAGGAAAGATGG - Intronic
1037008632 8:13812531-13812553 GTTGTAAGCAGAAGAGGAGATGG + Intergenic
1037134220 8:15443167-15443189 CTTCTAAAAAAAAGAAAGGAAGG - Intronic
1037180856 8:16004108-16004130 GTTGTAAAAAGAAGGAAAGCAGG + Intergenic
1038103694 8:24409515-24409537 GTTCCAAAGAAAAGAAAAAAAGG + Intergenic
1038601461 8:28947462-28947484 GTGCTGAAAGGAAGAAAAGAAGG - Intronic
1038817425 8:30919304-30919326 TTTCTAAAGAGAAGAAAGGATGG - Intergenic
1039068393 8:33629192-33629214 GTACTAAGCAGAAAAAAAAATGG - Intergenic
1039277434 8:35948846-35948868 TTTCAAAACAGAAAAAAGGAAGG + Intergenic
1040025797 8:42780899-42780921 ATTTAAAAAAGAAGAAAAGATGG - Intronic
1040452606 8:47563169-47563191 TTTCAAAAAAGAAAAAAAGAGGG - Intronic
1041046332 8:53890344-53890366 GGACTAAACTGATGAAAAGATGG - Intronic
1041259232 8:56005775-56005797 ATTTTATACAGAAAAAAAGAGGG + Intronic
1041341879 8:56854798-56854820 GTTCCAATCAATAGAAAAGAGGG - Intergenic
1041367497 8:57124220-57124242 GCTCTGAACAGAAGAAAAGAAGG + Intergenic
1042154650 8:65830522-65830544 TTTCTAAATATTAGAAAAGATGG - Intronic
1042622387 8:70720836-70720858 ATTCCAAACAATAGAAAAGAGGG - Intronic
1044681998 8:94789131-94789153 CTTCAAAACAGCAGAAAAGTGGG - Intronic
1045101754 8:98851603-98851625 GTTAAAAAAAGAAGAAGAGAAGG + Intronic
1045538983 8:103063258-103063280 GTACTAAGCAGAAGAAAAAGTGG + Intronic
1045573697 8:103396185-103396207 CTTCTAAACACACTAAAAGAGGG - Intergenic
1046742196 8:117841472-117841494 TTTCTAAACATAAGAAACGAGGG - Intronic
1046765363 8:118063683-118063705 GTTGTAAACCGAAGCAAGGATGG - Intronic
1046862816 8:119113652-119113674 GTTATAAACAGCAGAAGAAAAGG - Intergenic
1046926376 8:119793893-119793915 TTTTTAAACAGAAAAAAAAAGGG + Intronic
1046930464 8:119836786-119836808 AGTATAAACAGAAGAGAAGATGG + Intronic
1047329954 8:123877914-123877936 GTTCTAAATACAAGGAAAAAAGG + Intronic
1048023341 8:130561144-130561166 TTTGTTAACAGAAGAAAAAATGG + Intergenic
1048515805 8:135110141-135110163 GTTCTAAACATAAAAACAAAAGG - Intergenic
1048606618 8:135975109-135975131 ATTCTAAACAATACAAAAGAGGG - Intergenic
1048671890 8:136731863-136731885 GTTCTCAACAAATGAAAAGGAGG - Intergenic
1049458057 8:142704328-142704350 GTTATTAACTGAAGAAAAGTGGG + Exonic
1050174664 9:2857211-2857233 GTTGTAAAAAGCAGTAAAGAAGG + Intergenic
1050219678 9:3372949-3372971 GTTGCAAACACAAGAAAAAATGG + Intronic
1052123079 9:24741106-24741128 TTTCTTAACAGAAGAACAAAGGG - Intergenic
1052251221 9:26399614-26399636 GTTCAAAATAGAAGAGAACAGGG + Intergenic
1052391168 9:27880247-27880269 GTTCTAAAGAAAAGAAAACTTGG - Intergenic
1055500920 9:76901611-76901633 GTTTTAAAAAGAAAGAAAGACGG - Intronic
1055798564 9:80004217-80004239 GATCTTAACAAATGAAAAGATGG - Intergenic
1055813508 9:80178825-80178847 GGGCTCAAAAGAAGAAAAGAAGG - Intergenic
1056959996 9:91114760-91114782 ATTCTAGAGAGAAGAAAAGGAGG - Intergenic
1057029680 9:91765935-91765957 CTTCTAATCAGGAGAAATGAGGG - Intronic
1057786452 9:98091803-98091825 ATTCTAATGAGAAAAAAAGAGGG + Intronic
1058009622 9:99962066-99962088 GTTCTGAAGAGAAGAAAATATGG - Intronic
1058630130 9:106978082-106978104 GTTCTTATAAGAAGAAAAGAGGG - Intronic
1059055772 9:110977770-110977792 TTTTAAAACAGAAGGAAAGAAGG + Intronic
1059532584 9:115049684-115049706 TTTTTAATCAGAAGAAAAAAAGG + Intronic
1059683051 9:116605091-116605113 GGTAGAAAAAGAAGAAAAGAAGG + Intronic
1060780979 9:126412582-126412604 CTTTTAATCAGAAAAAAAGATGG - Intronic
1061181826 9:129028861-129028883 GTTCTAACCACAAAAAAAGTAGG - Intergenic
1061855406 9:133439346-133439368 ATTCTAGAAAGAAGAAAAGAAGG - Exonic
1186168359 X:6851324-6851346 ATTCTGAACAGAAGAAATGAAGG - Intergenic
1187024103 X:15415431-15415453 GTTTGAAACAGAGGAAAAAATGG - Intronic
1188228137 X:27627327-27627349 GTTTTAAAAAGAAAAAAAAAAGG - Intronic
1188925448 X:36037152-36037174 GTTCTGAACAGAAAAATGGATGG - Intronic
1189068621 X:37838753-37838775 ATTCTAAATAGAAGAAATGCTGG - Intronic
1189181574 X:39009399-39009421 GTTTTAAAAGGAAGAGAAGAGGG + Intergenic
1191226262 X:58047780-58047802 ATTTTAAACAGCAGAAAACAGGG - Intergenic
1192018868 X:67362603-67362625 ATTCTAAACAATAAAAAAGAGGG + Intergenic
1192085409 X:68091483-68091505 GTTCCAAACAGTAGACAAGCAGG + Intronic
1192706626 X:73533252-73533274 AAACTAAACAGAATAAAAGAAGG - Intergenic
1192758872 X:74074528-74074550 ATTCCAAACAATAGAAAAGAAGG - Intergenic
1193364813 X:80619694-80619716 GTTCCAAACAAAAGAAAAGGAGG - Intergenic
1193549750 X:82877317-82877339 CATCTAAAAAGAAAAAAAGAAGG + Intergenic
1193632416 X:83906355-83906377 GTCCTAAATAAAAGAAAAGGTGG - Intergenic
1194050661 X:89063513-89063535 TTTCTAAAAAGAAAAAAAAAAGG - Intergenic
1194884049 X:99290534-99290556 GCTCTGAAGAGAACAAAAGAAGG - Intergenic
1195649477 X:107270161-107270183 CTTCTAAACAATAGAAAAGAAGG + Intergenic
1195858659 X:109357752-109357774 GTTCTAAGAAGCAGAAAACAGGG + Intergenic
1196266909 X:113660453-113660475 GTTTCAAACAGTTGAAAAGAAGG + Intergenic
1196339330 X:114579601-114579623 GTTCTTACAAAAAGAAAAGAAGG + Intergenic
1196727029 X:118904976-118904998 ACTCTAAATAGAAGAAAAGAGGG - Intergenic
1197369415 X:125608585-125608607 TTTCTAAAGATAAGAAAAAACGG + Intergenic
1197450656 X:126611446-126611468 GATTTAAAAAGAAGAAAAAATGG + Intergenic
1197833504 X:130670724-130670746 TTTCTAAAAAAAAAAAAAGATGG + Intronic
1197986345 X:132269932-132269954 CTTCTAAGCAGAAAACAAGATGG - Intergenic
1198717853 X:139580548-139580570 AATCTAAACAGAAGAAAAGAAGG - Intergenic
1198824303 X:140683117-140683139 ATCTTAAACAAAAGAAAAGAGGG - Intergenic
1198934316 X:141889916-141889938 GTTTTTAACTAAAGAAAAGAAGG - Intronic
1199404309 X:147438424-147438446 GTTCTGAACATCAGAATAGATGG + Intergenic
1199715698 X:150506078-150506100 CTTCCAAACAGTACAAAAGAAGG + Intronic
1199902276 X:152187999-152188021 ATTCAAAACAGAAGGAAATATGG + Intronic
1200145594 X:153924842-153924864 AAGCAAAACAGAAGAAAAGATGG + Intronic
1200320909 X:155188639-155188661 GTCACAAACAGAAAAAAAGATGG - Intergenic