ID: 920642828

View in Genome Browser
Species Human (GRCh38)
Location 1:207770548-207770570
Sequence TGTCAGGGGTTAGGGGCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1536
Summary {0: 1, 1: 7, 2: 47, 3: 244, 4: 1237}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920642828 Original CRISPR TGTCAGGGGTTAGGGGCTGG GGG (reversed) Intronic
900039594 1:447193-447215 TGTCTGGGGGTAGGGGCTGGGGG + Intergenic
900061025 1:682169-682191 TGTCTGGGGGTAGGGGCTGGGGG + Intergenic
900397055 1:2457345-2457367 TGTGAGTGGCCAGGGGCTGGGGG + Intronic
900526225 1:3130116-3130138 TGTCCAGGGTCAGGGGCTTGGGG + Intronic
900700400 1:4045059-4045081 TGTCTGCGGTTGGGGGTTGGGGG + Intergenic
900816016 1:4846550-4846572 TGTCAGGTGTGGGGGGCTAGGGG - Intergenic
901082721 1:6592694-6592716 AGTCAGGGGGTAGGAGCAGGGGG + Exonic
901276272 1:7993596-7993618 TGCCAGGGGCTAGGGGTAGGGGG - Intergenic
901321972 1:8345584-8345606 AGGCAGGGACTAGGGGCTGGAGG + Intergenic
901410841 1:9082910-9082932 TGCCAGGGGCTGGGGGCAGGGGG + Intronic
901703057 1:11055746-11055768 TGTCTGGGGGTGGGGGTTGGGGG - Intronic
901729282 1:11267165-11267187 TTCCTGGGGTTAGGGGGTGGGGG + Intergenic
901847873 1:11995964-11995986 TGTCAGAGGTTTGGGCCTGGGGG + Intronic
902081333 1:13822926-13822948 GGTCACGGGTCAGGGGCTGATGG + Intronic
902266166 1:15266755-15266777 TGCCAGGGGTCAGGGGAAGGTGG - Intronic
902540214 1:17149239-17149261 TGTCACGGGTCAGGGCCCGGCGG - Intergenic
902866310 1:19282218-19282240 TGGGAGGGGTTAGGGTATGGGGG + Intergenic
903017257 1:20369117-20369139 TGCCATGGGTTTGGGGGTGGGGG - Intergenic
903157850 1:21460368-21460390 TCCCTGGGGTTGGGGGCTGGAGG - Intronic
903220779 1:21868658-21868680 TGACAGGGGTCAGGGGCCAGGGG + Intronic
903341488 1:22657571-22657593 TGTCAGGGGCTGGGGGAAGGAGG + Intronic
903594761 1:24485626-24485648 TGTCAGGGGTGGGGGGCTGGGGG - Intergenic
903645887 1:24896369-24896391 TGTCAGGGGTCAGTGGCACGGGG - Intergenic
903682616 1:25107236-25107258 TGAAAGGCGTCAGGGGCTGGAGG - Intergenic
904381149 1:30111986-30112008 TCTCAGGGGTTTCGGGCTGAGGG - Intergenic
904496214 1:30888285-30888307 TGGCAGTGGGAAGGGGCTGGAGG + Intronic
904597699 1:31657182-31657204 TGTCAGAGGGTGAGGGCTGGAGG - Intronic
905270485 1:36784226-36784248 AGTCAGAGGAAAGGGGCTGGAGG + Intergenic
905473281 1:38208513-38208535 TGACTTTGGTTAGGGGCTGGTGG + Intergenic
905551618 1:38845471-38845493 TGTCAGGGGTGGGTGGCTGGGGG + Intronic
905750194 1:40455752-40455774 TGTCAGGGGATGGGGGCTAGGGG - Intronic
905833509 1:41094995-41095017 TGCCAGGGGTTTGGGGGTGATGG - Intronic
906396455 1:45470612-45470634 TGTCATGGCTTAGGGCCTGGTGG - Intronic
906490988 1:46268350-46268372 TGCCAGGGATTAGGGGAGGGAGG - Intronic
907472946 1:54686092-54686114 AGCCAGAGGTTTGGGGCTGGGGG + Intronic
907638678 1:56162544-56162566 TGTCAGGGGTTAAGGGAAGCAGG + Intergenic
907813112 1:57891840-57891862 TGTCAGGGGGTGGGGTCTAGGGG + Intronic
908491689 1:64650903-64650925 TGGCTGGGGTTGGGGGCGGGGGG - Intronic
908558427 1:65281425-65281447 TGCCAGGGGCTAGGGGGAGGAGG - Intronic
908620020 1:65967865-65967887 TTCGAGGGGTGAGGGGCTGGGGG + Intronic
908685116 1:66709176-66709198 TGTCGGGGGTGGGGGGCTGGGGG - Intronic
908740321 1:67320884-67320906 TGTCATGGGGTGGGGGCTGGGGG - Intronic
909227128 1:73039982-73040004 TGTCAGGGGTTAAGGGTTTAGGG + Intergenic
909275696 1:73683797-73683819 TGTCAGGGTTGGGGGGCTAGGGG - Intergenic
909535802 1:76734898-76734920 TGTCAGGGGTGAGGGGCTAGGGG - Intergenic
909611794 1:77558776-77558798 TGTCAGGATTTAGGAGGTGGTGG - Exonic
909829655 1:80171677-80171699 TGTAAGTGTTTAGGGGCTGGGGG + Intergenic
909866906 1:80685534-80685556 TGTCAGGGGTTGAGGCTTGGAGG - Intergenic
910913096 1:92258748-92258770 TGTCAGGGTTCGGGGGCTAGGGG + Intronic
910991303 1:93059378-93059400 TGTCGGGGGTTGGGGGCTAGAGG - Intergenic
911038703 1:93575505-93575527 GGTCAGAGGTTAGGGGATGACGG - Intronic
911217424 1:95210831-95210853 TGTCAGGGGTGGGGGGCTGGGGG - Intronic
911252223 1:95589809-95589831 TGTCAGGGATAGGGGGCTAGGGG + Intergenic
911549314 1:99260398-99260420 TATCGGGGGTGAGGGGCTAGGGG - Intergenic
911963969 1:104341966-104341988 TGTCATGGGGTGGGGGCTGAGGG + Intergenic
911985077 1:104612328-104612350 TGTCAGGGGCTGGGGTCTAGGGG + Intergenic
912600773 1:110931130-110931152 TGTCAGGGGTTGGGGGGCTGGGG - Intergenic
913035688 1:114963519-114963541 TGTCAGGGGTTGGGGGCAAGGGG - Intronic
913046626 1:115078679-115078701 AGTCAGAGGTCAGGTGCTGGAGG - Intronic
913080671 1:115383482-115383504 TGTCGGGGGTGGGGAGCTGGGGG - Intergenic
913174136 1:116258403-116258425 TGTTGGGGGTTAGGGGGAGGAGG + Intergenic
913362590 1:117998976-117998998 TGTCGGGGGTAGGAGGCTGGGGG - Intronic
913513066 1:119580187-119580209 TGTTGGGGGTGAGGGTCTGGGGG + Intergenic
913540767 1:119818697-119818719 TGTCAGGAGGTAGGGGATTGGGG - Intergenic
913602427 1:120434502-120434524 TGTCATGGGGTGAGGGCTGGGGG - Intergenic
913710979 1:121483108-121483130 TGTCATGGGGTAGGGGGAGGGGG + Intergenic
913971611 1:143421675-143421697 GGTCAGAGGCCAGGGGCTGGCGG - Intergenic
914065988 1:144247288-144247310 GGTCAGAGGCCAGGGGCTGGCGG - Intergenic
914084621 1:144442006-144442028 TGTCATGGGGTGAGGGCTGGGGG + Intronic
914113163 1:144719066-144719088 GGTCAGAGGCCAGGGGCTGGCGG + Intergenic
914190632 1:145407273-145407295 TGTCATGGGGTGAGGGCTGGGGG + Intergenic
914343684 1:146780563-146780585 GGTCTGGGGTCGGGGGCTGGGGG - Intergenic
914363598 1:146958132-146958154 TGTCATGGGGTGAGGGCTGGGGG - Intronic
914488077 1:148128994-148129016 TGTCATGGGGTGAGGGCTGGGGG + Intronic
914588439 1:149084147-149084169 TGTCATGGGGTGAGGGCTGGGGG + Intronic
914640090 1:149597590-149597612 TGTCAGGGGGTGGGGGGTTGGGG + Intergenic
915342346 1:155183611-155183633 GGTCAGGGGTTTGGGTTTGGTGG - Intronic
915567561 1:156724249-156724271 TGTCACGGGTGAGGGACTTGGGG + Exonic
915614896 1:157029975-157029997 TTTCAGGGGTTAGGGGAAGGGGG + Intronic
915652198 1:157322375-157322397 TGTTAGGGGTTGGGGGCTAGGGG + Intergenic
915771238 1:158427162-158427184 TGTCAGGGGTTGGGGGCTAGGGG - Intergenic
916141122 1:161699127-161699149 TGTCAGGGGGTAGGGGTAAGGGG + Intergenic
916377556 1:164171921-164171943 TGTTGGGGGACAGGGGCTGGGGG + Intergenic
916635885 1:166667974-166667996 TGTCGGGGGTGGGGGGCTGGGGG + Intergenic
916804625 1:168247319-168247341 TGTCCGGGGGTGGGGGCTAGGGG - Exonic
917181973 1:172307867-172307889 TGTCATAGGGTGGGGGCTGGGGG + Intronic
917500526 1:175580924-175580946 TGTCAGGGGGTGGGGGATGGGGG + Intronic
917801454 1:178574374-178574396 TGGCAGGGGTTAGGGCCAGGGGG - Intergenic
918043567 1:180927717-180927739 TGGTAGGGGGTGGGGGCTGGTGG + Intronic
918080181 1:181201578-181201600 TGTCAGGGGGTGGGGGGTTGGGG + Intergenic
918412768 1:184277436-184277458 TTCCAGGGGTTGGGGGATGGAGG + Intergenic
918665310 1:187143390-187143412 TGTGGGGGGTTGGGGGCTAGGGG + Intergenic
918669398 1:187196439-187196461 TGTTGGGGGTTTGGGGCTGGGGG - Intergenic
918722668 1:187873792-187873814 TGTCATGGGGTAGGGGCAGTGGG - Intergenic
918887902 1:190220387-190220409 TGTCAGGGGTTGGGGGCTAGGGG + Intronic
919002641 1:191853390-191853412 TGTCATGGGTTGGGGGAGGGGGG - Intergenic
919053228 1:192537345-192537367 TGTCAAGGGGTGGGGGCTAGTGG - Intergenic
919292412 1:195649227-195649249 TCTCAGGGGGTGGGGGCTGGGGG + Intergenic
919467985 1:197945404-197945426 TGTTAGGGGGTAGGGGGTGAGGG - Intergenic
919586091 1:199442312-199442334 TGTTGGGGGTTAGGGGGTGAGGG - Intergenic
919770573 1:201155603-201155625 TGGCAGGGGGCAGGGGCAGGAGG + Intronic
920060912 1:203226320-203226342 TGTCAGGTTTCAGGGCCTGGAGG - Intronic
920429236 1:205905454-205905476 TGTCGGGGGGTGGGGGGTGGGGG + Intergenic
920443184 1:205995104-205995126 TGTCACGGGGTGGGGGCAGGGGG + Intronic
920642828 1:207770548-207770570 TGTCAGGGGTTAGGGGCTGGGGG - Intronic
920972177 1:210752313-210752335 TGCCAGGAGTTATGAGCTGGTGG - Intronic
921221321 1:212976062-212976084 TGTCAGGAGTCAGGAGGTGGTGG + Intronic
922330036 1:224566516-224566538 TGTCAGGGGATGGGGGATAGGGG - Intronic
922385482 1:225076939-225076961 TGTTGGGTGTTGGGGGCTGGGGG - Intronic
922545576 1:226454090-226454112 TGGCAGGGATTAAGGGGTGGTGG + Intergenic
922654172 1:227366321-227366343 TGTCAGGGGGGCGGGGATGGAGG + Intergenic
923688025 1:236167498-236167520 TGTCAGGGGCTGGGGGATGAGGG + Intronic
923857570 1:237861513-237861535 TGTCAGGGATTAGGGGTGTGTGG + Intergenic
923910748 1:238440507-238440529 TGTGTGGCGTTGGGGGCTGGGGG + Intergenic
924302623 1:242654776-242654798 TGTCAGGGGGTGGGGGGCGGGGG + Intergenic
924312100 1:242754766-242754788 TGACAGGGGTTAGTGCCTGCTGG + Intergenic
924381751 1:243471603-243471625 TATCAGGGGTTGGGGGGTGGAGG + Intronic
924957799 1:248945612-248945634 GGTTAGGGGTTAGGGGTTAGGGG + Intergenic
924957864 1:248945804-248945826 GGTTAGGGGTTAGGGGTTAGGGG + Intergenic
1062800840 10:379195-379217 TGTCAGGGGTTGTGGGGGGGGGG - Intronic
1062941926 10:1428653-1428675 TGTCATGGGTTAGAGATTGGGGG + Intronic
1063021156 10:2128585-2128607 TAACTGGGGTTAGGGCCTGGGGG + Intergenic
1063181290 10:3602975-3602997 TGTCAGGGGGTGTGGGGTGGGGG - Intergenic
1063723458 10:8609823-8609845 TGTCAGGGGATGGGGGGTGGGGG + Intergenic
1063747859 10:8906029-8906051 TGTCAGGGGGTCGGGGGTAGGGG + Intergenic
1063765375 10:9134242-9134264 TGTCGGGGGTGAGGGACTAGGGG - Intergenic
1064091862 10:12392375-12392397 TGGTAGGTGTCAGGGGCTGGGGG - Intronic
1064206751 10:13330980-13331002 TGTCGGGGGTAGGGGGCTGGGGG - Intronic
1064373831 10:14777754-14777776 TGTCAGGGGGTGGGGGCTGAGGG + Intergenic
1065157491 10:22885486-22885508 TCTCGGGGGTAGGGGGCTGGGGG + Intergenic
1065266814 10:23984757-23984779 TGTCAGGGGTTGGGGGCAAGGGG + Intronic
1065472535 10:26097532-26097554 TGTCATGGGGTGGGGGCAGGGGG - Intronic
1065509457 10:26463888-26463910 TGTCCGGGGTTGGGGGCAAGTGG - Intronic
1066608573 10:37210108-37210130 TGTTGGGGATGAGGGGCTGGGGG - Intronic
1066620729 10:37346454-37346476 TGTTGGGGGGTGGGGGCTGGGGG - Intronic
1066677722 10:37905780-37905802 TGTCAGGGGTTGGGGGCTGGGGG + Intergenic
1067522487 10:47018605-47018627 TGGCAGCTGCTAGGGGCTGGCGG + Intergenic
1067546773 10:47197489-47197511 TGTCAGGGGCTGGGGGCTGGGGG - Intergenic
1068219162 10:54021512-54021534 TGTGAGGGGTGAGGGGCTAAAGG - Intronic
1068402788 10:56552273-56552295 TGTCATGGGTTGGGGGGAGGGGG - Intergenic
1068412772 10:56678890-56678912 TGTCAGGGGTTGGGGGACGAGGG + Intergenic
1068511424 10:57971013-57971035 TGTCAGAGGGCAGGGGTTGGAGG + Intergenic
1068640368 10:59398483-59398505 TGTCAGGAGGTGGGGGCTAGGGG - Intergenic
1068922022 10:62494886-62494908 TGTCAGGGGTTGGGGGCAAGGGG - Intronic
1069296122 10:66846289-66846311 TGCCAGGGGCTAAGGGATGGGGG + Intronic
1069569754 10:69487168-69487190 TGCCCGGGGTCACGGGCTGGTGG - Intronic
1069757440 10:70781882-70781904 TGCCAGGGGTTTGGGGCTTTGGG + Exonic
1070152816 10:73815374-73815396 GTTCAGGGGTTCGGGGGTGGGGG - Intronic
1070168003 10:73912392-73912414 AGGCAGGAGTTAGGAGCTGGAGG + Intronic
1070802437 10:79251516-79251538 TGTATGGGGTGAGGGGTTGGGGG - Intronic
1070875146 10:79797236-79797258 TGTCGGGGGGTGGGGGCAGGGGG + Intergenic
1071176016 10:82927489-82927511 TGTCAGGGGGTGGGGGCCAGGGG - Intronic
1071364062 10:84880994-84881016 GTTAAGGGGTTGGGGGCTGGGGG - Intergenic
1071401248 10:85274548-85274570 TGTCAGTGGGTGGGGGCTAGGGG - Intergenic
1071554440 10:86591612-86591634 GGTGAGGGGCTGGGGGCTGGAGG + Intergenic
1071922379 10:90365958-90365980 TGTCAGGAGGTACGGCCTGGGGG - Intergenic
1072035579 10:91560476-91560498 TGGCAGGGGTAGGGGTCTGGAGG - Intergenic
1072379752 10:94855954-94855976 TGTCATGGGGTGGGGGATGGGGG - Intergenic
1072490528 10:95901265-95901287 TGTGGGGGGGTGGGGGCTGGAGG + Intronic
1072493134 10:95928553-95928575 TGTCAGGGGGTGGGGGCGAGGGG - Intronic
1072640269 10:97206361-97206383 GGTGAGGGGTTTGGGGGTGGAGG + Intronic
1072662516 10:97371461-97371483 TGTCCGGCGTTGGGGGTTGGGGG - Intronic
1073015027 10:100391838-100391860 TGGCAGGGGTTGGGGAGTGGGGG - Intergenic
1073457604 10:103647049-103647071 AGTCAGGGGTGGGGGGATGGAGG + Intronic
1074083328 10:110185589-110185611 TGTCAGGGGTGGGGGGCAAGGGG - Intergenic
1074282857 10:112069688-112069710 TGTCGGGGGTTGGGGGCGGCGGG - Intergenic
1074722433 10:116274162-116274184 TGTCAGGCGTGGGGGGCGGGGGG - Intergenic
1074781361 10:116804537-116804559 TGGCTGGGGCTGGGGGCTGGGGG - Intergenic
1074893617 10:117755949-117755971 AGTGAGGGGGTGGGGGCTGGAGG - Intergenic
1075047777 10:119159627-119159649 TGACAGGGGTCCGGAGCTGGAGG + Intronic
1075060534 10:119253784-119253806 TGCCTGGGGTGGGGGGCTGGAGG + Intronic
1075147620 10:119895743-119895765 TGGCAGGAGTTAGTGGTTGGTGG + Intronic
1075535357 10:123266987-123267009 TGTCAGGGGCTGGGGGGAGGAGG - Intergenic
1075728257 10:124621539-124621561 TCTCAGGGCTGTGGGGCTGGGGG + Exonic
1075773108 10:124957569-124957591 TGACAGTTGTCAGGGGCTGGAGG - Intronic
1076089376 10:127668517-127668539 TGTCACGGGTGGGGGGCTGGGGG - Intergenic
1076178403 10:128386434-128386456 TGTCAGGGGTCAGGGGTGGGAGG + Intergenic
1076178421 10:128386505-128386527 TGTCAGGGGTTGGGGGCGGGAGG + Intergenic
1076564338 10:131387803-131387825 TTTCAGGGGTTGGGGGAGGGAGG - Intergenic
1076714082 10:132354490-132354512 TGGCTGGGGCTGGGGGCTGGGGG + Intronic
1076965816 11:83105-83127 TGTCTGGGGGTAGGGGCTAGGGG + Intergenic
1077089596 11:772412-772434 TGACAGGGGTGAGTGTCTGGAGG - Exonic
1077328973 11:1975705-1975727 TGGCGGGGGATAGGGGGTGGGGG + Intronic
1077595810 11:3530437-3530459 TGTCAGGGCTTAGTGGGAGGAGG - Intergenic
1077613710 11:3660486-3660508 TGGAAGGGGTTGGGAGCTGGTGG - Intronic
1077655066 11:4010864-4010886 TGTTGGGGGCTGGGGGCTGGGGG - Intronic
1077933672 11:6760125-6760147 TGTCATGGGTGGGGGACTGGGGG - Intergenic
1077987503 11:7368511-7368533 TGTCAGGGGATGGGGGCAAGGGG - Intronic
1078158297 11:8817520-8817542 GGTCAGGGGTGGGGTGCTGGTGG - Intronic
1078168448 11:8910926-8910948 GGTCGGGGGTCGGGGGCTGGGGG - Exonic
1078322169 11:10346004-10346026 TGTCAGGGGTCGGGGGCTAGAGG + Intronic
1078462728 11:11527166-11527188 TGGCAGGGGACAGGGGTTGGGGG - Intronic
1078668334 11:13344025-13344047 TGTCAGGGGTCAGGGTGTGAGGG - Intronic
1078796268 11:14594904-14594926 TGTTGGGGGTTGGGGGCTGGGGG - Intronic
1079102418 11:17549841-17549863 TGACAGGAGTTGGGGGGTGGGGG + Intronic
1079352206 11:19701193-19701215 TCTAAGGGGTTGGGGGTTGGTGG + Intronic
1079399304 11:20092976-20092998 TGTCAGGGTGCAGGGGGTGGGGG - Intronic
1079550597 11:21692699-21692721 TGTCGGGGGTGGGGGGCTAGGGG - Intergenic
1079671856 11:23180847-23180869 TGTTGGGGGTTGCGGGCTGGGGG - Intergenic
1079813569 11:25026137-25026159 TGTCATGGGGTAGGGGGAGGGGG + Intronic
1080040688 11:27756608-27756630 TGTCGGGGGTTGGGGGCAAGGGG - Intergenic
1080042696 11:27775609-27775631 TGTCGAGGGTGGGGGGCTGGGGG + Intergenic
1080069795 11:28068266-28068288 TGTCAGGGGTAGGGGGCAAGGGG + Intronic
1080155982 11:29111586-29111608 TATCGGGGGTTGGGGGCTAGGGG - Intergenic
1080316050 11:30949850-30949872 TGTCGGGGGGTGGGGGCTAGGGG + Intronic
1080591696 11:33729512-33729534 TGTCGGGAGTTGGGGGGTGGGGG + Intronic
1080744503 11:35096620-35096642 TGTCATGGGGTGGGGGCAGGGGG + Intergenic
1080915998 11:36660377-36660399 TGCCAGGGTTTAGGGGAAGGGGG - Intergenic
1080981217 11:37408479-37408501 TGTCAGCGGGTGGGGGCTAGGGG + Intergenic
1081290140 11:41314644-41314666 TGTCAGGGGTGCGGGGCCGTGGG + Intronic
1081715843 11:45249744-45249766 TGTCAGGGGTGGGGGCCTGGGGG + Intronic
1081798385 11:45839010-45839032 TATCAGGGGGTGGGGGCTAGGGG + Intergenic
1081902753 11:46643198-46643220 GTTCAGGGGTTGGGGGTTGGCGG + Intronic
1082049163 11:47756690-47756712 TGTCATGGGGTCGGGGGTGGGGG - Intronic
1082166129 11:48953828-48953850 TGTCTGGGGTGGGGGGCTAGGGG - Intergenic
1082812108 11:57484622-57484644 TGTCCTGGGTTAGGGGTTGGGGG - Exonic
1082893073 11:58161090-58161112 TGTCTGGGGTCGGGGGCTGGGGG + Intronic
1083430870 11:62612977-62612999 CCTGAGGGGTTAGGGGCTGGGGG - Exonic
1083527975 11:63389327-63389349 TGTCGGGGGTTGGGGGAAGGGGG - Intronic
1084085483 11:66853113-66853135 GGGCAGGGGTGAGGGGCAGGGGG + Intronic
1084251709 11:67904416-67904438 TGTCAGGGCTTAGTGGGAGGAGG - Intergenic
1084381828 11:68817684-68817706 TGTCTGGGGTCAAGGGCAGGTGG + Intronic
1084593817 11:70105457-70105479 TGTGGGGGGTGGGGGGCTGGAGG + Intronic
1084821131 11:71691611-71691633 TGTCAGGGCTTAGTGGGAGGAGG + Intergenic
1085003951 11:73067326-73067348 TGTTGGGGGTTGGGGGCTAGAGG + Intronic
1085140541 11:74136795-74136817 TGTCGGGGGTAGGGGGCTAGGGG + Intronic
1085190304 11:74614753-74614775 TGTGTGGGGGTAGGGGATGGTGG + Intronic
1085611099 11:77950212-77950234 TGTCAGAGGGTGGGGGCTGGGGG + Intronic
1085969984 11:81577020-81577042 TATCTGTGGTTAGGGGCTGAAGG + Intergenic
1086067448 11:82761626-82761648 TGTCGGGGGGTGGGGGCTAGGGG - Intergenic
1086298940 11:85403336-85403358 TGTCAGTTGGTGGGGGCTGGGGG + Intronic
1086565189 11:88218340-88218362 TGTCATGGGTTGGGGGCAGGGGG - Intergenic
1086583117 11:88422161-88422183 TGTCCTGGGTTAGGGGATGTGGG + Intergenic
1086832477 11:91582936-91582958 TGTCTGGGGGTGGGGGATGGGGG + Intergenic
1086996525 11:93363199-93363221 TTTCAGGGATTAGGGGTTGGGGG + Intronic
1087359059 11:97134880-97134902 TCTCAGGGGTTGGGGGCTAGGGG + Intergenic
1087515241 11:99151867-99151889 TGTCAGGGGATGGGGGCAAGGGG + Intronic
1087564446 11:99836288-99836310 TGTCGGGGGTTGGGGGAGGGGGG - Intronic
1087741797 11:101896502-101896524 TGTCAGGGGGTGGGGGCTAGAGG - Intronic
1087954363 11:104266693-104266715 TGTCAGGGATCAGGGGCTAGGGG - Intergenic
1088403412 11:109445506-109445528 TGTCATGGGGTGGGGGCTGGGGG + Intergenic
1088523399 11:110724960-110724982 TGTCGGGGGTTGGGGGCTAGGGG - Intergenic
1088983424 11:114884578-114884600 TGTCATGGGGTAGGGGGAGGGGG - Intergenic
1090103231 11:123824305-123824327 TGTCGGGGGTTGGGGGCTGGGGG - Intergenic
1090104382 11:123836400-123836422 TGTCAGGGGGTAGGGGTGAGGGG - Intergenic
1090282111 11:125465205-125465227 TGGCAGGGGGTAGGGGGTGGTGG + Intronic
1090428797 11:126629079-126629101 TGGCAGGGGTTGGGGGGAGGTGG - Intronic
1090689414 11:129162141-129162163 TGTCAGGGGGTGGGGGCTAGGGG + Intronic
1090988595 11:131795777-131795799 TGACTGGGGTTGGGGGGTGGTGG + Intronic
1091090501 11:132766631-132766653 TGTGAGGGGTCAGGAGGTGGTGG - Intronic
1091224816 11:133951020-133951042 TGTCAGGGAGGAGGGGTTGGGGG - Intronic
1091372546 11:135073027-135073049 TGACAGTGGATAGGAGCTGGGGG - Intergenic
1202811952 11_KI270721v1_random:30884-30906 TGGCGGGGGATAGGGGGTGGGGG + Intergenic
1091373186 12:10425-10447 GGTTAGGGGTTAGGGGTTAGGGG - Intergenic
1091438071 12:489158-489180 TGTCAGGGGTTGGGGTGGGGGGG + Intronic
1091641502 12:2240800-2240822 TGCCAGAGGTCAGGGGGTGGGGG - Intronic
1091698461 12:2643776-2643798 TGGCAGGGGTCAGGGGCTGCTGG - Intronic
1091773256 12:3167729-3167751 TGGCAGGGGCTAGGAGCTGCTGG + Intronic
1092100177 12:5876823-5876845 TGTCAGGGGTAGGGGGTTAGGGG + Intronic
1092111919 12:5970254-5970276 TGTCAGGGGTCAGCGGGGGGTGG - Intronic
1092327623 12:7549924-7549946 TGTCAGGGGTTGGGGGTCTGGGG + Intergenic
1092394177 12:8110717-8110739 TATTAGGAGTTAGGGGATGGGGG - Intergenic
1092421978 12:8339208-8339230 TGTCAGGGCTTAGTGGGAGGAGG - Intergenic
1092513840 12:9186846-9186868 TGTCGGGGGTGGGGGGCTGGGGG + Intronic
1092550796 12:9496989-9497011 TGTCGGGGGTTGGGGGCAAGGGG + Intergenic
1092644782 12:10558583-10558605 TACCAGGGGTTGGGGGCTGGGGG - Intergenic
1092918732 12:13211798-13211820 TGTAGGTGGTTAAGGGCTGGAGG + Intronic
1093889614 12:24503819-24503841 TGTCAGGGGTTGGTGGGTAGGGG + Intergenic
1094097046 12:26718198-26718220 TGTCAGGGGGTGGGGGGTGAGGG - Intronic
1094134864 12:27114373-27114395 TGTCGGGGGTGGGGGCCTGGGGG - Intergenic
1094405766 12:30114833-30114855 TGTCATGGGGTAGGGGGAGGGGG - Intergenic
1094521022 12:31189380-31189402 TGTCGGGGGTTGGGGGCAAGGGG - Intergenic
1095128967 12:38514593-38514615 TGTCAGGGGGTGGGGGGTGAGGG + Intergenic
1095137249 12:38620039-38620061 TGTCAGGGGCTGAGGGGTGGGGG + Intergenic
1095565021 12:43612816-43612838 TGTCAGGGTGTGGGGGCTGGGGG + Intergenic
1095652124 12:44623981-44624003 TGTCAGGGGGTGGGGGCTAGGGG + Intronic
1095968099 12:47882938-47882960 TGGCAGGGGTGTGGGGGTGGCGG + Intronic
1096943418 12:55375721-55375743 TGTCGGGGGTGTGGGGCTAGGGG - Intergenic
1096997372 12:55847231-55847253 GCTCAGGGGGTAGGAGCTGGTGG - Intergenic
1097303138 12:58039837-58039859 TGTCATGGGGTGGGGGTTGGGGG - Intergenic
1097322366 12:58240405-58240427 TGTGTGGGGATAGGGGTTGGGGG + Intergenic
1097368640 12:58748155-58748177 TGTCAGGGGGTGGGGGCTGGGGG - Intronic
1097375306 12:58836195-58836217 TGTCGGGGGTGGGGGGCTAGGGG - Intergenic
1097412644 12:59273897-59273919 TGTCAGGGGGTGGGGGCTAGGGG + Intergenic
1097534765 12:60854413-60854435 TGACAGGGGTTGGGGGCTCAAGG + Intergenic
1097737852 12:63202202-63202224 TGTCATGGGGTGGGGGCAGGGGG + Intergenic
1097737896 12:63202588-63202610 TGTCAGGAGGTGGGGGCTAGGGG + Intergenic
1098106472 12:67072636-67072658 TGTCGGGGGTGGGGGGCTAGGGG + Intergenic
1098151301 12:67549860-67549882 TGTCGGGGGTGGGGGGCTAGGGG - Intergenic
1098349862 12:69547193-69547215 TGTCAGGGGATAGGGGGAGGAGG + Intronic
1098776658 12:74629202-74629224 TGTCGGGGGTAGGGGGCTAGGGG - Intergenic
1098835850 12:75423713-75423735 TGTCAGGGGGTCAGGGCTAGGGG - Intronic
1099275409 12:80569732-80569754 TGTCGGGGGTGGGGGGCTAGGGG - Intronic
1099511493 12:83544527-83544549 TGTCAGGGGCTGGGGGATTGGGG - Intergenic
1099523161 12:83688943-83688965 GGTCGGGGGTGGGGGGCTGGGGG + Intergenic
1100054002 12:90487310-90487332 TGTCGGGGGTGGGGGGCTAGGGG - Intergenic
1100417657 12:94395180-94395202 TGTCAGGGGGTGGGGGCCTGGGG + Intronic
1100428677 12:94510771-94510793 TTACAGGGGCTAGGGGATGGGGG - Intergenic
1100964271 12:99995589-99995611 TGTCAGGGGGTTGGGTGTGGGGG + Intergenic
1101054719 12:100900447-100900469 TGTCATGGGGTAGGGGGAGGGGG - Intronic
1101301131 12:103483807-103483829 TGTCATGTGGTGGGGGCTGGGGG - Intronic
1101512261 12:105404122-105404144 TGTCAGGGGTGGAGGGCTAGGGG - Intergenic
1101858188 12:108461627-108461649 TACCAGGGGCTAGGGACTGGGGG + Intergenic
1102190968 12:110988087-110988109 TGAAAGGGGCTAGGGGCTGGGGG - Intergenic
1102787890 12:115619215-115619237 TGTAAAGGGTTAGTGGGTGGGGG - Intergenic
1102871212 12:116415807-116415829 TGTCACGGGTGAGGGGATGGGGG + Intergenic
1102896657 12:116603625-116603647 GGGCAGGGGTTGGGGGGTGGGGG + Intergenic
1102907087 12:116685041-116685063 TGTCATGGGATTGGGGCTGGTGG + Intergenic
1103064983 12:117890022-117890044 TGGCAGGGAGTAGGGGTTGGGGG - Intronic
1103480398 12:121246826-121246848 TCTCAGGGGTAGGGGGCTGGGGG - Intronic
1104069175 12:125329737-125329759 TGTCAAGGGGCCGGGGCTGGGGG - Intronic
1104224309 12:126816369-126816391 TGTCAAGGGTGAGGGGATGGGGG - Intergenic
1104289315 12:127454346-127454368 TGTGGGGGGTTGGGGGGTGGGGG + Intergenic
1104431369 12:128719041-128719063 TGTCAGGGGGTGGGGGATGAGGG - Intergenic
1104459622 12:128944942-128944964 TGTTGGGGGTCGGGGGCTGGAGG - Intronic
1105072155 12:133241228-133241250 GGTTAGGGGTTAGGGGTTAGGGG + Intergenic
1105072159 12:133241235-133241257 GGTTAGGGGTTAGGGGTTGGGGG + Intergenic
1105072163 12:133241242-133241264 GGTTAGGGGTTGGGGGTTGGGGG + Intergenic
1105282257 13:18973292-18973314 TGTCAGGGGCTGGGGGAAGGGGG + Intergenic
1105355322 13:19654323-19654345 TGTCAGGGGGTAGGGGCTCCGGG + Intronic
1105356972 13:19667524-19667546 TGTCAGGGGCTGGGGGAGGGAGG - Intronic
1105691075 13:22839689-22839711 TGTCATGGGAGAGGGACTGGTGG + Intergenic
1106077403 13:26473168-26473190 TGACAGTGGTCAGGAGCTGGAGG - Intergenic
1106252659 13:27994530-27994552 TGGCGGTGGTGAGGGGCTGGAGG + Intergenic
1106338197 13:28803809-28803831 TGCCAGGGGCTGGGGGCAGGGGG - Intergenic
1106932002 13:34676663-34676685 TGTCATGGGGTAGGGGGAGGGGG - Intergenic
1107071409 13:36273882-36273904 AGTCATGTGTTAGAGGCTGGAGG - Intronic
1107136023 13:36944990-36945012 TGGAAGGGGTTGGGGTCTGGTGG - Intergenic
1107505005 13:41025158-41025180 TGTCAGGGGCTAGGGAGTGAGGG - Intronic
1108015280 13:46068687-46068709 TGTCGGGGGTGGGGGGCTAGGGG - Intronic
1108087347 13:46807714-46807736 TGTCAGGGGCTGGGGGCTAGGGG - Intergenic
1108361694 13:49673806-49673828 TGCCAGGGGTTAAGGGATGGAGG + Intronic
1108487796 13:50944448-50944470 TTTCGGGGGTTAGGGGCAAGAGG + Intronic
1109590749 13:64477560-64477582 TGTCAGGAGTTAGAGGAAGGGGG + Intergenic
1109714591 13:66204747-66204769 TGTCAGGGTTGAGGGGCAAGGGG + Intergenic
1109907716 13:68866351-68866373 TGTCAGGGGGTGGGGGCTAGAGG + Intergenic
1109939917 13:69348205-69348227 ACACAGGGGTTAGGGGGTGGGGG + Intergenic
1110091138 13:71449520-71449542 TGTCAGGGGTTGGGGGCTAGGGG + Intronic
1110151743 13:72263633-72263655 TGTCGGGGGATAGGGGCTAGGGG + Intergenic
1110213880 13:73004749-73004771 TGTCAGGGGCTAGGGGGTATGGG + Intronic
1110588930 13:77231004-77231026 TGTAAATGGTTAGTGGCTGGAGG + Intronic
1110606325 13:77437117-77437139 TGTCGGAGGGTGGGGGCTGGGGG + Intergenic
1110744593 13:79037761-79037783 TGTCAGAGGTAGGGGGCTGGGGG + Intergenic
1110907566 13:80911816-80911838 TGTCAGGGGTTGGAGGCTAGGGG - Intergenic
1110939586 13:81332164-81332186 TGTCAGGGGTTGGGGAAGGGAGG + Intergenic
1111282449 13:86044548-86044570 TGTCATGGGCTAGGGGGTGGGGG + Intergenic
1111284595 13:86072192-86072214 TGTCGGGGGTTGGGGGCAAGAGG + Intergenic
1111495855 13:89048828-89048850 AGTCAGGGGATAAGGGCTGAGGG + Intergenic
1111699859 13:91673075-91673097 TGTTGGGGGTTAGGGGGTGAGGG + Intronic
1111712621 13:91835729-91835751 TGTCGGGGGTTGGGGGGTGAGGG + Intronic
1111861853 13:93717756-93717778 TGTCAGGGGTGGGGGGCAAGGGG - Intronic
1111893729 13:94115327-94115349 TGTCAGAGGCAAGGGGTTGGTGG + Intronic
1112135883 13:96577161-96577183 TGTCAGGGGTTGGAGGCTAGGGG - Intronic
1113562481 13:111293243-111293265 TGTCAGGGGTGGGGAGCCGGGGG - Exonic
1113706314 13:112435320-112435342 TACCTGGGGGTAGGGGCTGGGGG + Intergenic
1113786062 13:113002583-113002605 GGTCAGGGCTCAGGGGCTGCTGG + Intronic
1114042290 14:18690014-18690036 TGTCAGGGGGTGGAGGCTAGGGG + Intergenic
1114134717 14:19834609-19834631 TGTCAGGGGGCAGGGGCGGTTGG - Intergenic
1114210772 14:20612544-20612566 TGTTAGGGGCTTGGGGGTGGAGG + Intergenic
1114510145 14:23252081-23252103 TGTCAGGGGTTGGGGGGCGTGGG + Intronic
1114547263 14:23512191-23512213 TGCAGGGGGTTGGGGGCTGGAGG + Intergenic
1114591702 14:23871064-23871086 TGTCAGGTGTGGGGGGCTAGGGG + Intergenic
1114669539 14:24401458-24401480 TCTCAGGGGTTAGGGGATCTGGG + Intronic
1114742123 14:25108202-25108224 TGTCAGGGGTGGGGGGCTAGGGG + Intergenic
1114789693 14:25643255-25643277 TGACAGAGGTTCGTGGCTGGAGG + Intergenic
1115043526 14:28960103-28960125 TGTCTGGGGGTGGGTGCTGGGGG + Intergenic
1115071658 14:29329870-29329892 TGTCAGGGGGTGGGGGCTAGGGG + Intergenic
1115294819 14:31813681-31813703 TGTCAGAGGTTGGGGGCCAGGGG - Intronic
1115538620 14:34397493-34397515 TGTCGGGGGTGGGGGGCTAGAGG + Intronic
1115698156 14:35922945-35922967 TGTCATGGGGTGGGGGATGGGGG + Intronic
1115773841 14:36694058-36694080 TGTCAGGGGTTGGGGGGCTGGGG - Intronic
1115866556 14:37754233-37754255 TGTCAGGGGTCAGGGGCAAGGGG - Intronic
1115962970 14:38856636-38856658 TGTCAGGGGGTGGGGGCAAGGGG - Intergenic
1116205740 14:41863828-41863850 TGTTGGGGGTTGGGGGCTAGGGG - Intronic
1116360888 14:43996425-43996447 TGTTGGGGGTTGGGGGATGGGGG + Intergenic
1116423292 14:44759356-44759378 TGCCAGGGGCTAGGGGGAGGCGG + Intergenic
1116565896 14:46443645-46443667 TGTCGGGGGTGGGGGGCTAGGGG + Intergenic
1116692719 14:48131188-48131210 TGTCGGGGGTGGGGGGCTGAGGG - Intergenic
1116754432 14:48928051-48928073 TGTCAGGGGGTAGGGGGCTGGGG + Intergenic
1117044892 14:51803387-51803409 TGTCAGGGGTTGGGGGCTGGGGG + Intergenic
1117199944 14:53379677-53379699 TGTCGGGGGTTGGGGGCATGGGG - Intergenic
1117241505 14:53838288-53838310 TGTTGGGGGTTGGGGGCTGGGGG + Intergenic
1117246582 14:53892314-53892336 TGGCAGGGGTGGGGGGGTGGAGG - Intergenic
1117351700 14:54887494-54887516 TGGCAGGGGTTGGGGGCGGTAGG + Intronic
1117583945 14:57180944-57180966 TACCAGGGGTGAGGGGATGGGGG + Intergenic
1117639060 14:57777626-57777648 TCGCGGGGGTGAGGGGCTGGGGG + Intronic
1117656003 14:57957284-57957306 TGTCAGGGGGTAGGGGCTAGGGG + Intronic
1117893500 14:60451682-60451704 CGTCATGGGGTAGGGGGTGGGGG + Intronic
1117928012 14:60805568-60805590 TGTCAGGGGTTGGGGTAGGGAGG - Intronic
1118495089 14:66300453-66300475 TGTCAGGGGTGGGGGCCTGGGGG + Intergenic
1118551164 14:66952198-66952220 TGTCAGGGGCTGGGGGCAGAGGG - Intronic
1118794667 14:69130402-69130424 TGGCAGTGGCCAGGGGCTGGGGG + Intronic
1118826896 14:69391781-69391803 GATCAGGGGTTTGGGGGTGGTGG + Intronic
1118829402 14:69416065-69416087 TGTCGTGGGGTGGGGGCTGGGGG - Intronic
1119416114 14:74470569-74470591 TGGCACGGGTTTGGGGATGGAGG + Intergenic
1119683003 14:76606826-76606848 GGTCAGGGGTTTGGGGGTGGAGG + Intergenic
1119930019 14:78536752-78536774 TGTCATGGGTGGGGGGCTGGGGG - Intronic
1120016995 14:79485341-79485363 TGTCAGGAGTTGGGGGGTGGTGG - Intronic
1120066310 14:80044821-80044843 TGTCAGGGGGTGGGGGTTTGGGG + Intergenic
1120070475 14:80097084-80097106 TGTCAGGGGTTGGCGGCAAGGGG + Intergenic
1120351764 14:83369922-83369944 TGTCGGGGGTGGGGGGCTAGGGG - Intergenic
1120429929 14:84400947-84400969 TGTCAGGGGTAGGGAGCAGGGGG + Intergenic
1120564799 14:86042486-86042508 TGTCAGGGGTTGGGGGCTAGGGG - Intergenic
1120624651 14:86809976-86809998 TGTCAGGGGTTGGGGGCAAGGGG - Intergenic
1120697068 14:87656683-87656705 TGTCAGGGATTATTAGCTGGAGG + Intergenic
1120717917 14:87860005-87860027 TGTCAGGGGGTGGGGGGTTGGGG + Intronic
1120810651 14:88800004-88800026 TGTCAGGGGTGGGGTGCTAGGGG - Intergenic
1121328826 14:93036958-93036980 TGTTAGGGGGTGGGGGCCGGGGG - Intronic
1122403373 14:101480878-101480900 AGTCAGGGCTCAGGGGCGGGGGG + Intergenic
1122822656 14:104355000-104355022 GGGCAGGGGCTGGGGGCTGGGGG + Intergenic
1122832992 14:104412189-104412211 TGTCATGGGGTAGGGGGAGGGGG - Intergenic
1122982525 14:105198043-105198065 TGGGAGGGGTCAGGGGCTGGGGG + Intergenic
1122982526 14:105198050-105198072 GGTCAGGGGCTGGGGGCTGAAGG + Intergenic
1123057714 14:105579868-105579890 TGGCAGGGGTGAGGAGGTGGGGG - Intergenic
1123080648 14:105692067-105692089 TGGCAGGGGTGAGGAGGTGGGGG + Intergenic
1123081994 14:105699801-105699823 TGGCAGGGGTGAGGAGGTGGGGG - Intergenic
1202899975 14_GL000194v1_random:29349-29371 GGTCAGGGGTTAGGGGTCAGGGG + Intergenic
1123509713 15:20984788-20984810 TTTCAGGGGTGGGGGGCTAGGGG + Intergenic
1123566933 15:21558527-21558549 TTTCAGGGGTGGGGGGCTAGGGG + Intergenic
1123603197 15:21995820-21995842 TTTCAGGGGTGGGGGGCTAGGGG + Intergenic
1124003829 15:25780525-25780547 GGTGAGGGGTGAGAGGCTGGAGG - Intronic
1124178298 15:27447846-27447868 TGTCAGGGGTAAGGGGGCTGGGG + Intronic
1124383626 15:29188407-29188429 TGTCAGGGGGTGGGGGCAAGGGG - Intronic
1124385205 15:29202631-29202653 TGTCAGGGGTTGGGGGCAAGGGG - Intronic
1124431314 15:29611190-29611212 AGTCCGGGGCTAGGGACTGGGGG - Intergenic
1124608517 15:31191417-31191439 TGCCAGGGGCTGGGGGCAGGAGG + Intergenic
1124936049 15:34171931-34171953 TGTCATGGGGTGGGGGGTGGGGG + Intronic
1125057480 15:35378820-35378842 TGTCAGGGGTGGGGGGCTGGGGG + Intronic
1125155499 15:36580074-36580096 TGTCAGGCGTTAGGAGGTCGAGG + Intronic
1125473769 15:40030120-40030142 AGGCAGGGGTTGGGGGGTGGTGG - Intronic
1125529061 15:40399636-40399658 TGGCTGGGGTTGGGGGGTGGTGG - Intergenic
1126073957 15:44890691-44890713 TGTCAGGGGGTGGGGGCCTGGGG - Intergenic
1126189341 15:45863546-45863568 TGTCAGGGGTCAGGGGGAAGGGG - Intergenic
1126658479 15:51006993-51007015 TACCAGGGGTTGGGGGCAGGAGG - Intergenic
1126897899 15:53279652-53279674 TGTCAGGGGGTAGGGGCAAGGGG - Intergenic
1127070095 15:55280653-55280675 TCTCAGGGGGTGGGGACTGGGGG - Intronic
1127194264 15:56567413-56567435 TGTCAGGGGTGGGGGACTGGGGG + Intergenic
1127453246 15:59136756-59136778 GGTCAGGGGCTGGGGGCTGGGGG - Exonic
1127541974 15:59949281-59949303 TGCCAGGGGTTAGGAGTTGTGGG + Intergenic
1127807330 15:62533407-62533429 AGGGAGGGGTTAGGGGATGGGGG - Intronic
1128312811 15:66642033-66642055 CCTCAGGGCTTAGGGCCTGGAGG - Intronic
1128425809 15:67541722-67541744 CGGCAGGGGTTGGGGGCTGGTGG + Intergenic
1129013933 15:72449093-72449115 TGTCAAGGGTTAGGAATTGGGGG + Intergenic
1129415097 15:75372080-75372102 GCTCATGGGTGAGGGGCTGGAGG - Exonic
1129919364 15:79307147-79307169 TACCAGGGGCTAGGGGGTGGGGG - Intergenic
1130085763 15:80777742-80777764 TGTTAGGGGTTTGGGGGTGCTGG - Intergenic
1130774505 15:86964777-86964799 TGTCAGGGGTTGGGGGGTAGGGG - Intronic
1130986991 15:88851104-88851126 GGTCAGGGGTGGGAGGCTGGGGG - Intronic
1131328514 15:91472388-91472410 TGCCAGGTGTTAGGGGTTGGGGG - Intergenic
1131446964 15:92507022-92507044 TGCCAGGGGTTAGAGGAGGGAGG + Intergenic
1131941383 15:97570001-97570023 TGTTCGGGGCTGGGGGCTGGGGG - Intergenic
1131997604 15:98147265-98147287 TGTCACTGGGCAGGGGCTGGGGG + Intergenic
1132096959 15:98993669-98993691 TGTCAGGCGGTGGGGGGTGGGGG + Intronic
1132225966 15:100141655-100141677 TGGCTGGGGTTGGGGGCTGCCGG + Intronic
1132442316 15:101880420-101880442 TGTCTGGGGGTAGGGGCTGGGGG - Intergenic
1132453417 15:101980834-101980856 GGTTAGGGGTTAAGGGTTGGGGG + Intergenic
1132453476 15:101981008-101981030 GGTTAGGGGTTAGGGGTTAGGGG + Intergenic
1202975294 15_KI270727v1_random:285621-285643 TTTCAGGGGTGGGGGGCTAGGGG + Intergenic
1132538966 16:498824-498846 TTTTAGGGGCTAGGGGCTAGGGG + Intronic
1132983793 16:2753040-2753062 TGTCATGGGGGAGGGGCGGGGGG - Intronic
1133052641 16:3125853-3125875 TGTCAGGGGGCAGTGGCTTGAGG + Intergenic
1133118274 16:3590586-3590608 TGTCAGGGAAAGGGGGCTGGAGG - Exonic
1133346077 16:5071434-5071456 TGTTAGAAGTTAGGGGCTGGTGG - Intronic
1133376313 16:5290369-5290391 TGTCAGGGCTTAGTGGGAGGAGG + Intergenic
1133578801 16:7123030-7123052 TGCCAGGGATTAGGGGTTGGGGG + Intronic
1133605790 16:7386375-7386397 TGTTGGGGGGTGGGGGCTGGGGG - Intronic
1133616739 16:7484004-7484026 TGCCAGGGGTTAGGGAATGGGGG - Intronic
1133899820 16:9963427-9963449 TGTCAGGGGTGGGGGGCAAGAGG - Intronic
1133903515 16:9999586-9999608 TGTCAGGGGTTGGGGGCTAGGGG + Intronic
1133918941 16:10134472-10134494 TGTCAGGGGGTAGGGGGCTGGGG + Intronic
1134378914 16:13706287-13706309 TGTCAGGGGTTAGGAAGAGGAGG + Intergenic
1134769094 16:16789870-16789892 TGTCAGGGGTTGGGGGGCTGGGG - Intergenic
1134793903 16:17016844-17016866 TATCAGAGGCTAGTGGCTGGGGG - Intergenic
1135072667 16:19365726-19365748 TGCCAGGGGTGAGGGGTGGGGGG + Intergenic
1135288518 16:21214523-21214545 TGACAGGGGTTGGGGGGTGGGGG + Intergenic
1135472189 16:22741205-22741227 TGTCAGGGGTCGGGGGCAAGGGG - Intergenic
1135624202 16:23981497-23981519 TGTCAGGGGGTCGGGGGTAGGGG + Intronic
1135759889 16:25128902-25128924 TGTCAGGGGTGGGGGGCAAGGGG + Intronic
1135778184 16:25275558-25275580 TGCCAGGGTTTAGGGGTGGGTGG + Intergenic
1135953659 16:26938046-26938068 TGTCAGGGGTTGGGGGGCTGGGG - Intergenic
1136076494 16:27820811-27820833 TGTCTGGGGTTGGAGGCTGGTGG - Intronic
1136570392 16:31093396-31093418 GGGCAGGGGTTTCGGGCTGGTGG - Exonic
1136735517 16:32462890-32462912 GGTCAGGGGTTAGGGGTCAGGGG + Intergenic
1137729998 16:50682365-50682387 TGTCAGGGGTGGGGGCCAGGGGG - Intergenic
1137972509 16:53000153-53000175 TGTCATGGGGTGGGGGTTGGGGG + Intergenic
1138383463 16:56619629-56619651 TGTCAGGGGTCGGGGGTTGGGGG - Intergenic
1138483473 16:57319432-57319454 TGTCAGGGGGTGGGGGCAAGGGG + Intergenic
1138661005 16:58516756-58516778 TGTCTTGGGTGAGGGACTGGGGG - Intronic
1138673209 16:58631792-58631814 TGTCAGGGACTAGGGGGAGGGGG - Intergenic
1138673786 16:58636263-58636285 TGTCAGGGGGTGGGGGCAAGGGG + Intergenic
1138887448 16:61096682-61096704 TGTCAGGGGGTGGGGGCAAGGGG + Intergenic
1139109146 16:63867744-63867766 TGTTAGGGGGTGGGGGCTGGGGG - Intergenic
1139267987 16:65657509-65657531 TCTCAGTGGGCAGGGGCTGGTGG - Intergenic
1139990308 16:70934771-70934793 GGTCTGGGGTCGGGGGCTGGGGG + Intronic
1140330749 16:74054500-74054522 TCTGAGGGGTCAGAGGCTGGTGG + Intergenic
1140619426 16:76710265-76710287 TGCCAGGGGTTAGAGGGTGGAGG - Intergenic
1141026237 16:80551506-80551528 TGTCAGGGGTCAAGGGTTGGAGG - Intergenic
1141193057 16:81838604-81838626 TGTCAGGGGGTGGGGGCAAGGGG + Intronic
1141608881 16:85170270-85170292 AGTCCGGGGTTAGGCGCCGGCGG + Intergenic
1141931717 16:87209305-87209327 TGTCGGGGGGTTGGGGCTTGGGG + Intronic
1203017616 16_KI270728v1_random:366905-366927 GGTTAGGGGTTAGGGGTTAGGGG - Intergenic
1203035951 16_KI270728v1_random:640063-640085 GGTTAGGGGTTAGGGGTTAGGGG - Intergenic
1142977852 17:3656165-3656187 TGGCAGGGGGTGAGGGCTGGCGG - Intronic
1143620003 17:8075351-8075373 TGTCTGAGATTAGGGGCTGTGGG - Intronic
1144196023 17:12896098-12896120 TGTCATGGGATAGGGGGAGGGGG + Intronic
1144440319 17:15275594-15275616 TGTCATGGGATAGGGGGAGGGGG - Intergenic
1144464517 17:15486339-15486361 TGTCAAGGGTTAGGGGAGAGAGG + Intronic
1144541929 17:16152299-16152321 TGTCAGGGGGTGGGGCATGGGGG - Intronic
1144830828 17:18130396-18130418 TGTGAGAGGTAAGGGGTTGGGGG + Intronic
1144938784 17:18921985-18922007 TGCCAGGGGCTGGGGGATGGGGG - Intronic
1145238270 17:21224191-21224213 TGCCAGGGGCTGGGGGCAGGAGG + Intergenic
1145908656 17:28530030-28530052 TGTCAGGGGTTGGGGGCAAGGGG + Intronic
1146507627 17:33418948-33418970 TGTCAGGGGTGGGGGGCTGGGGG + Intronic
1146815733 17:35940673-35940695 TGCCAGGGGTTGGGAGGTGGGGG - Intronic
1147250939 17:39152074-39152096 TTTCTGGGGGTGGGGGCTGGAGG - Intronic
1147577001 17:41608245-41608267 TGTCGGGGGTGGGGGGCTGTGGG + Intergenic
1147612716 17:41811287-41811309 GGTCGGGGGGTAGGGGGTGGGGG + Intronic
1147882273 17:43661480-43661502 AGACAGGGGCTGGGGGCTGGAGG + Exonic
1147970511 17:44217236-44217258 TTTAAGGGGCTAGGGGGTGGTGG - Intronic
1148893983 17:50829337-50829359 TGGCAGGGGTGGGGGGCTGGGGG + Intergenic
1149087447 17:52734973-52734995 TGTCAGGGGTTAGGGGAAAAGGG + Intergenic
1149223514 17:54441732-54441754 TGTCAGGGGGTAGGGGCAGGGGG + Intergenic
1149235693 17:54588186-54588208 TGTCGGGGGTGGGTGGCTGGGGG - Intergenic
1149390745 17:56187927-56187949 TGTCGTGGGGTAGGGGGTGGGGG + Intronic
1149659574 17:58327249-58327271 TGTCTGTCCTTAGGGGCTGGGGG - Intronic
1149660511 17:58332016-58332038 AGTCAGGACTTTGGGGCTGGTGG - Intergenic
1149923269 17:60678238-60678260 TGAGAGGGCTGAGGGGCTGGAGG + Intronic
1150004207 17:61459841-61459863 TGTGAGGGGTGAGGGGTTGGGGG - Intronic
1150685300 17:67315918-67315940 TGCCAGGGGCTAGGGGGAGGAGG - Intergenic
1151082946 17:71349443-71349465 TGTCAGAGGTGGGGGCCTGGTGG - Intergenic
1151325715 17:73378842-73378864 TGTATGGGGTTGGGGGCTGGTGG + Intronic
1151498351 17:74473245-74473267 AGTCAGGGGCTGAGGGCTGGGGG + Intronic
1151662107 17:75524797-75524819 AAGCAGGGGTGAGGGGCTGGGGG - Intergenic
1151807371 17:76414530-76414552 TGTCAGGGGTGAGGGCGTGGGGG - Intronic
1151898998 17:76999271-76999293 TGTCAGGCATTAGGGCCAGGAGG + Intergenic
1152144070 17:78557157-78557179 TGTGAGGGGCTAGGAGGTGGCGG - Intronic
1152170911 17:78747583-78747605 TGTCAGGGGTTTGGGGATGCGGG - Intronic
1152540460 17:80971925-80971947 TGGCAGGAGCTGGGGGCTGGGGG + Intergenic
1152952438 17:83247159-83247181 GGTTAGGGGTTAGGGGTTAGGGG + Intergenic
1153072617 18:1123429-1123451 TGTCGGGGGGTGGGGGCTAGGGG - Intergenic
1153456314 18:5286379-5286401 TGTCATGGGTTAGTGGTTAGTGG - Intergenic
1153506744 18:5808276-5808298 TGTCTGGGGTGGGGGGCTAGGGG - Intergenic
1153717303 18:7863345-7863367 TGTCGGGGGTGAGGGGCTGGGGG - Intronic
1153906295 18:9664612-9664634 TGTCAGGGGCTAGGGGCAGTGGG - Intergenic
1154139615 18:11811338-11811360 TGTGAGGGGCAAGGGGCAGGAGG - Intronic
1154184117 18:12166869-12166891 TGTCATGGGGTGGGGGTTGGGGG - Intergenic
1154303145 18:13212346-13212368 TGTCAGGGGAGAGCGGGTGGCGG - Intergenic
1154498914 18:14984674-14984696 TGTCAGGGGTTAGGGGTTATGGG - Intergenic
1155333146 18:24738140-24738162 TGTGTGGGGGTGGGGGCTGGGGG + Intergenic
1155461305 18:26087243-26087265 TGTCACGGGTTGAGGGGTGGGGG + Intronic
1155647959 18:28103647-28103669 TCTCAGGGGATGGGGGCTAGGGG - Intronic
1155657970 18:28213294-28213316 TGTCAGGGGGTGGGGGCTACGGG - Intergenic
1156071751 18:33219770-33219792 TGTCATGGGGTTGGGGGTGGAGG + Intronic
1156124511 18:33887565-33887587 TGTCAGGGGGTGGGGGCTGGGGG - Intronic
1156210150 18:34930726-34930748 TGCCAGGAGTTGGGGGCTGGGGG + Intergenic
1156876644 18:42022285-42022307 TGTCATGGGGTTGGGGATGGGGG - Intronic
1156965342 18:43084727-43084749 TGTCAGGGGTTGGGGACTAGGGG + Intronic
1157080868 18:44523572-44523594 TGTCATGGGGTGGGGGCAGGGGG + Intergenic
1157414660 18:47491983-47492005 TGTCGGGGGTTGGGGGCTAGGGG - Intergenic
1157750549 18:50174357-50174379 TCTCAGGAGCTAGGGGCTGATGG - Intronic
1157854545 18:51092994-51093016 TGTCAGGGGGTGGGGGCCTGGGG - Intergenic
1157955702 18:52095193-52095215 TGTCAGGGGTGGGGGGCTGGGGG + Intergenic
1158214297 18:55083326-55083348 TGTCAGAGTTTAGGGGGAGGGGG + Intergenic
1158308565 18:56133837-56133859 TGTCAGGGGGTCGGGGCTAAGGG + Intergenic
1158392147 18:57052512-57052534 TGGCATGGGTTGGGGGTTGGGGG + Intergenic
1158556580 18:58480041-58480063 TGCCAGGGGTTGGGGGGTTGGGG + Intergenic
1158812154 18:61050477-61050499 TGTCAGTGGGTAGGGGGTTGGGG - Intergenic
1158853975 18:61523907-61523929 TGTCAGGGGTCGGGGGCTAGGGG + Intronic
1158879557 18:61764098-61764120 TGCCAGGGGCTAGGAGCAGGGGG + Intergenic
1159395987 18:67856274-67856296 TGTCAGGGGTAGGGGACTAGGGG + Intergenic
1159756443 18:72371428-72371450 TGTCAGGGGTCAGGGGCAGAAGG + Intergenic
1160010815 18:75106017-75106039 TGGCAGGTGGCAGGGGCTGGGGG - Intergenic
1160173729 18:76576393-76576415 TGTCAGGGGTTAGAGGGAAGGGG + Intergenic
1160184333 18:76663228-76663250 TGTCAGGGGGTGGGGGCTAGGGG - Intergenic
1160184628 18:76665944-76665966 TGTCAGGGGTTAGGGATGGTGGG + Intergenic
1160192457 18:76725147-76725169 TGTCAGGGGTTGGGGGCTAGGGG + Intergenic
1160381731 18:78462490-78462512 TGTCAGGGGTTGGGGCCAGAGGG - Intergenic
1160551517 18:79696512-79696534 TGGCCGGGGGTAGGGGCGGGGGG + Intronic
1160574506 18:79844384-79844406 TGCCAGGGGATTGGGGGTGGAGG + Intergenic
1160642620 19:152735-152757 TGTCTGGGGGTAGGGGCTAGGGG + Intergenic
1161041793 19:2114404-2114426 TGGCTGGGGCCAGGGGCTGGAGG - Intronic
1161241575 19:3226071-3226093 GGTCAGGTGTTGGGGACTGGGGG + Intronic
1161290224 19:3490218-3490240 TGTCATGGGGTGGGGGGTGGGGG - Intergenic
1161858919 19:6783298-6783320 TGTCAGGGGTTGGGGGAGGAGGG + Intronic
1162777837 19:12990424-12990446 TGGGAGCGGTAAGGGGCTGGAGG - Intergenic
1162884930 19:13689900-13689922 TGTCATGGGGTAGGGGGAGGGGG + Intergenic
1162897655 19:13774919-13774941 TGGCGAGGGATAGGGGCTGGGGG + Intronic
1162955060 19:14092836-14092858 TGGGAGGGCTGAGGGGCTGGGGG + Exonic
1163111755 19:15165601-15165623 TTTCAGGGGTTGGGGTATGGGGG - Intronic
1163336778 19:16678007-16678029 TGCCAGGGGCTAGGCGATGGGGG + Intronic
1163481894 19:17561449-17561471 AGGAAGGGGTCAGGGGCTGGGGG + Intronic
1163481897 19:17561456-17561478 GGTCAGGGGCTGGGGGGTGGTGG + Intronic
1163572212 19:18089179-18089201 TGTCAGGGGCTGGGGGGAGGCGG + Intronic
1163642694 19:18470478-18470500 TCTCAGGGGTCAGAGGTTGGGGG - Intronic
1164093600 19:21983846-21983868 TGTCAAGGGGTGGGGGCTAGGGG + Intronic
1164414590 19:28036002-28036024 TTCCAGGGGTCAGGGACTGGTGG + Intergenic
1164655179 19:29915867-29915889 TGTCATGGGGTCGGGGATGGGGG - Intergenic
1164693186 19:30225931-30225953 TGTCAGCGGGTGGGGGGTGGGGG + Intergenic
1164834678 19:31349634-31349656 TGCGCGGGGTTCGGGGCTGGGGG + Intergenic
1165245575 19:34496665-34496687 TGTGGGGGGTTGGGGGTTGGGGG + Intronic
1165550668 19:36582146-36582168 TGCCAGGGGCTGGGGGCAGGGGG + Intronic
1165697643 19:37912962-37912984 TGGTGGGGGTGAGGGGCTGGTGG + Intronic
1165731147 19:38145813-38145835 TGCCAGGGGTTAGGCACAGGGGG - Intronic
1165894673 19:39134333-39134355 GGACAGGGGTTATGGGCAGGCGG - Intronic
1165928512 19:39342158-39342180 GGCCTGGGGTTTGGGGCTGGGGG - Intronic
1166043734 19:40217770-40217792 TGACAGGGGTCTGTGGCTGGAGG - Intronic
1166254049 19:41589845-41589867 GGTCTGGGGGAAGGGGCTGGTGG - Intronic
1166263716 19:41663014-41663036 TGTCAGGGGTGGAGGGCTAGGGG + Intronic
1166272723 19:41726720-41726742 TCTCATGGGTGAGGGGCTTGAGG - Intronic
1166305456 19:41934796-41934818 TGTGAGGGAGGAGGGGCTGGGGG + Intergenic
1166373863 19:42316265-42316287 TCTGAGGGGGTAGGGGGTGGGGG + Intronic
1166399449 19:42467485-42467507 TGTGAGGGGTTGGGAGGTGGAGG + Intergenic
1166409501 19:42547170-42547192 TGTCTGGGGGAAGGGGCTGGTGG + Intronic
1166530456 19:43539987-43540009 TGTCAGGGGGTGGGGGTGGGGGG + Intergenic
1166531591 19:43546420-43546442 TCTGAGGGATGAGGGGCTGGGGG - Intronic
1166558261 19:43715966-43715988 TGTCAGGGGGTGGGGCCCGGAGG - Intergenic
1166662101 19:44654030-44654052 TCTCAGGGAGGAGGGGCTGGGGG + Intronic
1166689565 19:44814321-44814343 TCACAGAGGTCAGGGGCTGGGGG - Intronic
1166727463 19:45037633-45037655 TGTCAGTGGTTCAGGGCCGGGGG - Exonic
1166757621 19:45203104-45203126 TGCCTGGGGTTTGGGGCTCGGGG + Intronic
1166794798 19:45419909-45419931 TCTCAGGGAGGAGGGGCTGGGGG - Intronic
1166794814 19:45419947-45419969 TCTCAGGGAGGAGGGGCTGGGGG - Intronic
1166914299 19:46184414-46184436 TGTCGGGGGTGGGGGACTGGGGG - Intergenic
1166991829 19:46697429-46697451 AGTCTGGGGTTAGGGCGTGGGGG - Intronic
1167055929 19:47111912-47111934 TCTTAGGGGTTTGGGGTTGGGGG - Intronic
1167266042 19:48483351-48483373 TCTCAGGGAGGAGGGGCTGGGGG - Intergenic
1167342117 19:48922194-48922216 TGTGAGGGAGGAGGGGCTGGGGG + Intronic
1167388912 19:49181461-49181483 GGTGAGGGGTCAGGGCCTGGGGG + Exonic
1168152911 19:54458610-54458632 GGACAAGGGTTGGGGGCTGGGGG - Intronic
1168250327 19:55137905-55137927 TCTGAGGGGGCAGGGGCTGGGGG - Intronic
1168252144 19:55147236-55147258 TGTGAGGGAGGAGGGGCTGGGGG + Intronic
1168263173 19:55207924-55207946 TCTGAGGGAGTAGGGGCTGGGGG + Intronic
1168327773 19:55546820-55546842 TGTGAGGGAGGAGGGGCTGGAGG - Intergenic
1168558321 19:57362274-57362296 GGTCAGGGGTGGGGGGCAGGGGG - Intergenic
924958159 2:10300-10322 GGTTAGGGGTTAGGGGTTAGGGG - Intergenic
924995924 2:360790-360812 TGTCAGGGGTTGGGGGAGTGGGG + Intergenic
925492777 2:4413224-4413246 TGTGATGGGTGAGGGGATGGCGG - Intergenic
926203581 2:10818951-10818973 TGCCAGGGGTCAGGGGGAGGGGG - Intronic
926529896 2:14031542-14031564 TGTCAGAGGGTGGGCGCTGGGGG - Intergenic
926531385 2:14050536-14050558 TATCAGGGGTTGGGTGTTGGAGG - Intergenic
926817976 2:16819597-16819619 TGTCAGGGGGTGGGGGCTAGGGG - Intergenic
926939719 2:18122121-18122143 TGTCAGGGGTCGGGGGGAGGCGG + Intronic
926970081 2:18458354-18458376 TGTCATGGGTTGGGGGCTAGGGG - Intergenic
927117806 2:19922563-19922585 TGTAGGGGGTGGGGGGCTGGGGG + Intronic
927337109 2:21937853-21937875 TGTCGGGGGTGAGGGGCTAGGGG - Intergenic
927411561 2:22831768-22831790 TGTAAGGGGGTGGGGGCTAGGGG + Intergenic
927842019 2:26450874-26450896 TGTCGGGGGGTGGGGGCTAGGGG - Intronic
929025197 2:37594337-37594359 TGTTGGGGGTAGGGGGCTGGGGG - Intergenic
929165761 2:38879615-38879637 TGCCAGGGGTTTGGGGTTGTGGG + Intronic
929536004 2:42784459-42784481 TGGGATGGGTTAGGGGCTGTGGG + Intronic
929919922 2:46164632-46164654 TGTCAGGTGGTTGGTGCTGGAGG + Intronic
930015452 2:46967414-46967436 TGCCAGGGGTTAGGGGAGGAGGG - Intronic
930099624 2:47592871-47592893 TGCCAGGGGATAGGGGGAGGAGG + Intergenic
930188245 2:48431513-48431535 TGCCAGGGGTGGGGGGCAGGAGG + Intergenic
930264171 2:49180671-49180693 TGTCAGGGGTGGGGGCCTAGGGG - Intergenic
930267396 2:49215779-49215801 TGTCATGGGGTGGGGGCAGGGGG + Intergenic
930286628 2:49437030-49437052 TGTCAGGGGTGGAGGGCTAGGGG + Intergenic
930307867 2:49699015-49699037 TTTCAGGGGTGGGGGGCTAGGGG + Intergenic
930460593 2:51669217-51669239 TGTCAGGGGTTAGGGGAAGAAGG + Intergenic
930466028 2:51750880-51750902 TGTCAGGGGTAGGGGGTTAGGGG - Intergenic
930731744 2:54734530-54734552 TGTCAGGGGTGATGGGTTAGAGG + Intronic
930902078 2:56519982-56520004 TGCCAGGGGTAAGTGGGTGGAGG - Intergenic
931105442 2:59050137-59050159 TGTCAGGGGCCAGGGAGTGGAGG - Intergenic
931193114 2:60024616-60024638 GGTTGGGGGTTGGGGGCTGGTGG - Intergenic
931478578 2:62616556-62616578 TGTCAGGGGTTGGGGGCTAATGG - Intergenic
931666154 2:64610741-64610763 TGTAAGAGGTTGGGGGCTGGGGG + Intergenic
931900944 2:66787419-66787441 TGGCAGGGGGTAGAGGATGGAGG - Intergenic
931949630 2:67348567-67348589 TCTCAGGGGATGGGGGGTGGTGG - Intergenic
932213710 2:69952766-69952788 TTCCAGGGGATAGGGGATGGGGG - Intergenic
932486274 2:72086111-72086133 AATCAGGGTTGAGGGGCTGGCGG - Intergenic
932532749 2:72554901-72554923 TGTCAGGGGTTGGGGGTCTGGGG - Intronic
932869713 2:75386404-75386426 TGTCAGGGGATAGGGTCAAGGGG - Intergenic
932874457 2:75435805-75435827 TGTCAGGGATTGGGGGCATGGGG + Intergenic
933094925 2:78166004-78166026 TGTCGGGGGTGGGGGGCTAGGGG + Intergenic
933567217 2:83964964-83964986 TGTCATGGGGTGGGGGTTGGGGG + Intergenic
933653521 2:84868431-84868453 TGTCATGGGGTAGGGGGAGGGGG + Intronic
933679448 2:85086859-85086881 TGTCGGGGGTGAGGGGCAAGGGG - Intergenic
933880981 2:86669683-86669705 TGTCATGGGGTGGGGGCAGGGGG + Intronic
934176307 2:89582608-89582630 GGTCAGAGGCCAGGGGCTGGCGG - Intergenic
934286617 2:91656969-91656991 GGTCAGAGGCCAGGGGCTGGCGG - Intergenic
934556332 2:95288874-95288896 TGTCAGGGCTGAGGGTCTGGGGG + Intronic
935276079 2:101476226-101476248 TGCCAGGGGCTGGGGGTTGGGGG + Intergenic
935484296 2:103633546-103633568 TGTCAGGTGTGGGGGGCTAGGGG + Intergenic
935969754 2:108519262-108519284 TGCCAGGAGTTAGGAGTTGGGGG + Intergenic
936043836 2:109171018-109171040 TGCCAGGTGCTGGGGGCTGGGGG + Intronic
936133419 2:109867496-109867518 TGCCAGGAGTTAGGTGTTGGGGG + Intergenic
936211278 2:110503989-110504011 TGCCAGGAGTTAGGTGTTGGGGG - Intergenic
936274541 2:111083029-111083051 TGTCAGGGGGTTGGGGTTAGGGG + Intronic
936411701 2:112264349-112264371 TGTCTGGGCTTAGTGGCAGGAGG - Intergenic
936420417 2:112358558-112358580 TGCCAGGAGTTAGGAGTTGGGGG - Intergenic
936442361 2:112565810-112565832 AGGAAGGGGATAGGGGCTGGAGG - Intronic
936488789 2:112951834-112951856 TGTCAGGGGTGAGGTGGGGGAGG - Intergenic
936707359 2:115090441-115090463 TGTCAGGGATTTGGGGAGGGGGG + Intronic
937068073 2:119034244-119034266 TGTCAGGGGGTGGGGGGTTGGGG + Intergenic
937101989 2:119278740-119278762 TGTCAGGAGTTGGGGGCAAGGGG + Intergenic
937108867 2:119346621-119346643 TGCCAGGGGTTAGGGGAAGAGGG + Intronic
937130663 2:119510131-119510153 TGTCAGGGGGTAGGGGGCTGGGG - Intronic
937562205 2:123240095-123240117 TGTCAGAGATTAGTGGTTGGGGG - Intergenic
937697722 2:124826640-124826662 TGTGAGAGGGTAGGGGTTGGAGG - Intronic
937707869 2:124941955-124941977 TGTGAGGGCTTGGGAGCTGGAGG - Intergenic
937733615 2:125262775-125262797 TGTCAGAGGGTGGGGGCTGGGGG - Intergenic
937918358 2:127111995-127112017 TGCCAGGGGCTGGGGGGTGGAGG - Intergenic
938113793 2:128589920-128589942 TGACTGGGGTTCTGGGCTGGTGG + Intergenic
938254180 2:129841850-129841872 TGTTGGGGGGTGGGGGCTGGGGG - Intergenic
938497878 2:131812761-131812783 GGTCAGGGGTTAGGGGTTATGGG - Intergenic
939103852 2:137926690-137926712 TGTCAGGGGTTGGGGGCAAGGGG - Intergenic
939106371 2:137953107-137953129 TTTCAGGGGTTAAGGGCTGTGGG - Intergenic
939165658 2:138638713-138638735 TGCCAGGGGTTGGGGGCAGAGGG + Intergenic
939380334 2:141427020-141427042 TGTCAGGGGTGGAGGGCTAGGGG - Intronic
939424484 2:142016673-142016695 TGTTGGGGGGTAGGGGCTAGGGG + Intronic
939474963 2:142674999-142675021 TGTCGGGGGTGGGGGGCTAGGGG + Intergenic
939761552 2:146188189-146188211 TGTTAGAGGTTAGGGAATGGGGG + Intergenic
941651906 2:168101202-168101224 TGTCGGGGGTTAGGGGCAAGGGG + Intronic
941951550 2:171161026-171161048 TGCCAGGGGCTGGGGGGTGGGGG + Intronic
942669421 2:178358078-178358100 GTCCAGGGGTGAGGGGCTGGGGG + Intronic
942874805 2:180782556-180782578 TGTCAGGGGTTGGGGGGCTGGGG - Intergenic
942889134 2:180965540-180965562 TGTCAGGGGGTGGGGGTAGGAGG + Intergenic
943265555 2:185727112-185727134 TGTCAGAGGTTGGGGGCAAGGGG - Intergenic
943568834 2:189548157-189548179 TTTCAGAGGTTAAGCGCTGGAGG + Intergenic
943660916 2:190558317-190558339 TGTTTGGGGTTAGGGGCTAGGGG + Intergenic
943908317 2:193529599-193529621 TGTCAGGGGGTAGGGGGCTGGGG - Intergenic
944152089 2:196570547-196570569 TGTCATGGGGTAGGGGGTAGGGG + Intronic
944261394 2:197681650-197681672 TGTTAGGTGTCAAGGGCTGGGGG - Intergenic
944342977 2:198625148-198625170 TGTCAGGGGGTTGGGGGTGGTGG - Intergenic
944378523 2:199077536-199077558 TGTCGGGGGTTGCGGGCTAGGGG + Intergenic
944389224 2:199200231-199200253 TGACAGGGCAGAGGGGCTGGGGG + Intergenic
944687183 2:202127964-202127986 TGCCAGGGGCTAGGGGAGGGAGG - Intronic
944712759 2:202349947-202349969 TGTCAGGGGCTAGAGGGAGGGGG + Intergenic
945132684 2:206590785-206590807 TGTCAGGGGATAGGAGCAAGGGG + Intronic
945639339 2:212403713-212403735 TGCCAGGGACTAGGGGCTTGGGG + Intronic
945941174 2:215951926-215951948 TGCCAGGGGATAGAGGGTGGGGG - Intronic
945988030 2:216370832-216370854 TCTCAGGTGGTAGGGGTTGGGGG + Exonic
946116197 2:217464543-217464565 GGGCAGGGGTCAGGAGCTGGGGG + Intronic
946122071 2:217524620-217524642 TGTCGGGGGTTGGGGGCAGGGGG + Intronic
946241297 2:218357514-218357536 TGTCTGGGGTGAGGGGCCCGTGG - Exonic
946242778 2:218367238-218367260 TGCTTGGGGTCAGGGGCTGGAGG - Intronic
946280065 2:218659976-218659998 TGGCCGGGGTTCGGGGTTGGAGG + Exonic
946307819 2:218865999-218866021 TGGGTGGGGGTAGGGGCTGGGGG + Intronic
946310216 2:218879101-218879123 TGTCAGGAATTAAGGGCTTGAGG - Intergenic
946328406 2:218996685-218996707 AGTCATGGGTGAGGGGGTGGGGG - Intergenic
946337011 2:219044510-219044532 GGTCAGGGGGTGGGGGCTGGAGG + Intergenic
946418526 2:219552368-219552390 GGTCCGGGACTAGGGGCTGGGGG + Intronic
946511458 2:220361327-220361349 TGTCATGGGTTGTGGGCAGGGGG + Intergenic
946883582 2:224200778-224200800 TGTCAGAGTAAAGGGGCTGGGGG + Intergenic
947105090 2:226660905-226660927 TGACAGGGATTAGGGGCATGTGG - Intergenic
947193444 2:227536164-227536186 TGTCGGGGGTGGGGGGCTGGGGG - Intronic
947489666 2:230582676-230582698 TGCCAGGGATTAGGGGCAGAGGG + Intergenic
947559550 2:231135998-231136020 TGTCTGGAGTTTGAGGCTGGAGG + Intronic
947712646 2:232324939-232324961 TGGCAGGTGGTAGGGGTTGGGGG - Intronic
947819102 2:233058538-233058560 TGTGAGAGGTGGGGGGCTGGGGG + Intergenic
948224148 2:236295752-236295774 TGCCAGGGGCTGGGGGCAGGTGG - Intergenic
948415094 2:237797367-237797389 TGCCAGGGGCCAGGGGCTGAGGG - Intronic
948690409 2:239699013-239699035 TGTTAGGGGCTGGGGGCTGGGGG - Intergenic
948690413 2:239699020-239699042 TGGTGGGTGTTAGGGGCTGGGGG - Intergenic
948790997 2:240376830-240376852 TGCCAGGGTAGAGGGGCTGGTGG - Intergenic
1169457073 20:5761251-5761273 TGTCAGGGGTTAGGGTCAAGGGG + Intronic
1169685754 20:8269230-8269252 TGTCAGGGGTTGGGGGGATGGGG - Intronic
1169749746 20:8979922-8979944 TGTCGGGGGTTGGGGGCAAGGGG - Intergenic
1169805329 20:9553491-9553513 TGGCAGGGTTTTGGGGCTGTGGG - Intronic
1169843050 20:9960712-9960734 TGTCGGGGGTTGGGGGCTAGGGG + Intergenic
1169882217 20:10359086-10359108 TGTCAGGGGGTGGGGGGTAGGGG + Intergenic
1170021538 20:11841773-11841795 TGTCAGGCGTGGGGGGCTGGGGG - Intergenic
1170277665 20:14609804-14609826 TGTCTGGGGTCATGGGCTGTGGG + Intronic
1170335965 20:15270442-15270464 TGCCAGGGGTTAGGTGTTAGGGG + Intronic
1170347675 20:15405114-15405136 TGTCAGAGGATAAGGGCAGGGGG + Intronic
1170517002 20:17140458-17140480 TGTCGGGGGTAGGGGGCTAGGGG + Intergenic
1170607539 20:17885071-17885093 GATCAAGGGTTGGGGGCTGGAGG - Intergenic
1170827070 20:19805863-19805885 TGTTGGAGGTTGGGGGCTGGGGG - Intergenic
1170960934 20:21025316-21025338 TGCCAGGGGCTGGGGGGTGGGGG + Intergenic
1170969574 20:21104616-21104638 AGTCAGGGGTTGGAGGGTGGGGG - Intergenic
1170970011 20:21106540-21106562 TGTCTGGGTTTGGGGGCTGGGGG + Intergenic
1171182548 20:23101474-23101496 TGTCAGGGGTTAAGGTGGGGTGG + Intergenic
1171193869 20:23181417-23181439 TGTCAGGGGTTTGGGGGCTGGGG - Intergenic
1172647948 20:36483299-36483321 GGTCAGTGGTCAGGGGCTAGAGG + Intronic
1172841726 20:37906042-37906064 TGTCTGGGGGTGGGGGGTGGGGG + Intronic
1172843689 20:37916900-37916922 TGCCAGGGGTTAGGGGAGAGTGG + Intronic
1172882087 20:38208708-38208730 TGTCTGGGGCTAGAGGATGGAGG + Intergenic
1173144926 20:40516219-40516241 TGTCAGGGGGTGGGGGCCTGGGG - Intergenic
1173297610 20:41773115-41773137 TGTCAGGGGTTCAGGGGTAGGGG - Intergenic
1173915480 20:46705177-46705199 AGTCAGGAGTTAGAGGCTGAAGG + Intergenic
1174052410 20:47776154-47776176 TGTCAGGCTATAGGGGATGGTGG + Intronic
1174281040 20:49439537-49439559 TGACAGGGGACAGGGGCGGGAGG - Intronic
1174552519 20:51372336-51372358 TGACTCGGGGTAGGGGCTGGAGG + Intergenic
1174693401 20:52532185-52532207 TGTCAGGGGGTAGGGGGTTGGGG + Intergenic
1174725665 20:52859200-52859222 TGCCAGTGCTTAGGGGCTAGTGG - Intergenic
1174753802 20:53138573-53138595 TGGCAGGGGTTGGGGGGTGGAGG - Intronic
1174873249 20:54202824-54202846 TGTCAGGGGTAGGGGGCAAGGGG - Intergenic
1174914047 20:54636610-54636632 GGCAAGGGGTTAGGGGATGGGGG - Intronic
1174931130 20:54816169-54816191 TGCCAGGGGTGGGGGGCTAGGGG + Intergenic
1175014672 20:55776775-55776797 TGTCAGGGGAGTAGGGCTGGGGG - Intergenic
1175026794 20:55910888-55910910 TGTAGGGGGGTGGGGGCTGGTGG + Intergenic
1175153035 20:56950091-56950113 GCTGAGGGGTTAGGGGCTTGGGG - Intergenic
1175478473 20:59294031-59294053 TGTCTGGGGATAGCTGCTGGAGG - Intergenic
1175518499 20:59584655-59584677 TGTTAGGGGCTGGGAGCTGGAGG - Intronic
1175727836 20:61331704-61331726 TGTCAGGTGGTCGGGGCAGGAGG - Intronic
1176069659 20:63219490-63219512 TCTGAGGGGTTTGGGGGTGGTGG - Intergenic
1176178970 20:63740838-63740860 TGGCAGGGGTTGGGAGGTGGCGG - Intronic
1176619349 21:9044123-9044145 GGTCAGGGGTTAGGGGTCAGGGG + Intergenic
1176642232 21:9316604-9316626 TGTTGGGGGTTGGGGGCGGGGGG + Intergenic
1176794290 21:13359604-13359626 GGTCCGGGGTTAGGGGTTAGGGG - Intergenic
1176989410 21:15477254-15477276 TGTCAGGGAGTTGGGGATGGGGG + Intergenic
1177203655 21:17986310-17986332 TGTCAGGGGTGGGGGGCTAGGGG - Intronic
1177220396 21:18185168-18185190 TGCCAGGGGTAGGGGGCTAGGGG - Intronic
1177221991 21:18207030-18207052 TGTCAGGGGTTGGGGGCTGGAGG - Intronic
1177335177 21:19715421-19715443 TTTCATGGGTTAGGGTTTGGGGG + Intergenic
1177524466 21:22273865-22273887 TGTCAGGGGTAGGTGGCTGGGGG + Intergenic
1177728378 21:24996403-24996425 TGTCAGGGGTGGGGGACTAGGGG - Intergenic
1177841993 21:26245178-26245200 TGTCAGGGGATGGGGCCTCGTGG + Intergenic
1178238484 21:30871775-30871797 TGTCAGGGGGTGGGGGGTTGTGG - Intergenic
1178257386 21:31066731-31066753 TGTCATGGGGTAGGGGGAGGGGG + Intergenic
1178337714 21:31758630-31758652 TGTGAGGTGATGGGGGCTGGTGG - Intergenic
1178463418 21:32824094-32824116 TGTCAGGGGGTGGGGGGTTGGGG + Intergenic
1178789775 21:35689216-35689238 TGTCAGGAGATTGGGGCTGGAGG + Intronic
1179371124 21:40806955-40806977 TATCGGGGGTGAGGGGCTAGGGG + Intronic
1179529602 21:42009818-42009840 GGGCAGGGGTTGGGGGCCGGCGG - Intronic
1180179474 21:46111593-46111615 TGCCAGGGGTCGGGGGCCGGGGG + Intronic
1180179500 21:46111655-46111677 TGCCAGGGGTCGGGGGCCGGGGG + Intronic
1180179526 21:46111717-46111739 TGCCAGGGGTCGGGGGCCGGGGG + Intronic
1180179552 21:46111779-46111801 TGCCAGGGGTCGGGGGCCGGGGG + Intronic
1180179578 21:46111841-46111863 TGCCAGGGGTTGGGGGCCGGGGG + Intronic
1180351242 22:11805957-11805979 TGTTGGGGGTTGGGGGCGGGGGG + Intergenic
1180835284 22:18926574-18926596 TGGCAGGGGTGCAGGGCTGGTGG - Intronic
1180950901 22:19720057-19720079 TGCCAAGGGTGAGGGGCTGAGGG + Intronic
1180957400 22:19747160-19747182 GGTCAGGGGCTGAGGGCTGGGGG - Intergenic
1180996925 22:19970418-19970440 TGGCTGGGCTTTGGGGCTGGTGG - Exonic
1181034080 22:20161605-20161627 TGCCAAGAGTTGGGGGCTGGGGG + Intergenic
1181299435 22:21868674-21868696 AGTAAGGGATTAGGGGGTGGTGG + Intergenic
1181670600 22:24424018-24424040 TGCCGGGGGTCCGGGGCTGGTGG + Intronic
1181889120 22:26046150-26046172 TGTTGAGGGTTAGGGGATGGGGG + Intergenic
1182070419 22:27459551-27459573 TGTCAGGTGCTGGGGGCTTGGGG - Intergenic
1182445690 22:30387887-30387909 GGGCAGGGGAAAGGGGCTGGGGG + Intronic
1182707077 22:32290244-32290266 TGTCAGGGGATGGGGGCAAGGGG - Intergenic
1182717943 22:32374721-32374743 TGACGGGGGTTGGGGGCTAGGGG + Intronic
1182865227 22:33598519-33598541 TGTCAGGGGGTGGGGGCCTGGGG - Intronic
1182986742 22:34725442-34725464 TGTCAGGGGGTCGGGGAAGGGGG + Intergenic
1183050682 22:35257985-35258007 TGTCAGGGGGAAAGGGCTCGTGG + Intronic
1183379173 22:37482267-37482289 TGGAAGGTGTTAGTGGCTGGTGG - Intronic
1183481820 22:38069395-38069417 GGTGAGGGGTAAGGGGCTGAGGG - Intronic
1183642620 22:39101558-39101580 TGGCAGGGGCTGGGGGTTGGGGG + Intronic
1184374550 22:44103451-44103473 TGGCAGGGGTTTGGGGGTGAGGG - Intronic
1184392311 22:44211536-44211558 TGTTAGGGGCTAGGGGCTAGGGG - Intronic
1184547712 22:45183069-45183091 TGGCAGGGGTTGGGGGCGGGGGG + Intronic
1184677903 22:46053646-46053668 GGCCAGGGGCTGGGGGCTGGGGG + Intronic
1184995419 22:48202697-48202719 TGCCAGGGGCTGGGGCCTGGAGG + Intergenic
1185099833 22:48833196-48833218 TGGCGGGTGTTAGAGGCTGGGGG - Intronic
1185172969 22:49304223-49304245 GGGCAGGGGTTAGGACCTGGAGG + Intergenic
1185343797 22:50302748-50302770 TGACAGGGGCAAGGGGCAGGTGG - Intronic
1185430626 22:50808265-50808287 GGTTAGGGGTTAGGGGTTAGGGG + Intergenic
1203285372 22_KI270734v1_random:151873-151895 TGGCAGGGGTGCAGGGCTGGTGG - Intergenic
949397724 3:3633017-3633039 TGTCAGGGGTTGGAGGATGGGGG + Intergenic
949432657 3:3994491-3994513 TGTCGGGGGTTGGGGGCTAGGGG - Intronic
949493897 3:4613628-4613650 TGTCAGGGTTTGGAGGTTGGAGG - Intronic
949790627 3:7788083-7788105 TGTCAGGAGTTAGCAGCTGGAGG + Intergenic
949917374 3:8975401-8975423 TGTAAGGTGTTGGGGGTTGGGGG + Intergenic
950253093 3:11483186-11483208 TGACCTGGGTTAGGGGCAGGGGG - Intronic
950815747 3:15700292-15700314 TGTCCGGGGTGGGGGCCTGGGGG + Intronic
950935939 3:16839326-16839348 TGTGAGGGTTGAGGGACTGGTGG + Intronic
950941668 3:16898911-16898933 TGGCAGGGGTTGGAGGGTGGAGG + Intronic
950966536 3:17150630-17150652 ATTCAGGGGTTAGGGTATGGGGG + Intergenic
951122100 3:18941151-18941173 TGTCGGGGGTCGGGGGCTAGGGG + Intergenic
951131858 3:19055984-19056006 TGTCAGGGGTGAGGGGCTGGGGG + Intergenic
951376628 3:21926279-21926301 TGTCAGGGATGAGGGACTAGGGG - Intronic
951479543 3:23144865-23144887 TGTCAGGGGGTGGGGGCTGGGGG + Intergenic
952227896 3:31397979-31398001 TGTCAGGGGTTGGGGGCCAAGGG - Intergenic
952294899 3:32052798-32052820 TGTCAGGAGTTGGGGGCAAGGGG + Intronic
952460623 3:33521887-33521909 TGTCAAGGGGCTGGGGCTGGTGG - Intronic
952503202 3:33983474-33983496 TGTCAGGGGGTGGGGGCAGTGGG + Intergenic
952842040 3:37654838-37654860 TGTCAGGGGTGGGGGGTTAGGGG - Intronic
952969202 3:38640466-38640488 TTTAAGGGCTTAGGGCCTGGTGG - Intronic
953374986 3:42421037-42421059 TGTGAGGGGTGAGGAGGTGGGGG - Intergenic
953462537 3:43093363-43093385 TGGGAGGGGTTAGGGACTAGGGG - Intronic
954100202 3:48366537-48366559 TGCCAGGGGTTAGGGGTGGTGGG + Intergenic
954151350 3:48658872-48658894 TGTCACAGGTGAGGGGCAGGGGG - Exonic
954601347 3:51872860-51872882 TGTCAGGGGCTAGGGGAGGGAGG + Intergenic
955011351 3:55018328-55018350 TGTAGGGGGTTAGAGGGTGGGGG - Intronic
955092995 3:55770791-55770813 TGTCAGGGGTGGGGGGCAAGGGG - Intronic
955145924 3:56319458-56319480 TGTCAAGGGCTAGGGGGAGGAGG + Intronic
955244613 3:57212937-57212959 TGTCGGAGGTGAGGGGCTGGAGG - Intronic
955338190 3:58104296-58104318 TGCTGGTGGTTAGGGGCTGGTGG + Intronic
955505876 3:59632682-59632704 TGTCAGGGATGAGGGGCTCATGG + Intergenic
955865283 3:63375566-63375588 TGTCATAGAGTAGGGGCTGGGGG + Intronic
956309471 3:67863355-67863377 TGTCAGGGGATGGGGGCTAGGGG - Intergenic
956405162 3:68920983-68921005 TGTCTGGGGTTGAGTGCTGGGGG + Intronic
956606927 3:71082471-71082493 TGTCAGGGGGTGGGGGGTAGGGG + Intronic
956835772 3:73095043-73095065 TGGCAGGAGTGAGGGGCTGCTGG + Intergenic
956911830 3:73826164-73826186 TTTGTGGGGTTAGGGGATGGAGG + Intergenic
957016056 3:75066447-75066469 TGTCATGGGGTGGGGGCAGGGGG - Intergenic
957672822 3:83327585-83327607 TGTCAGGGGTTGGGGACAGGGGG + Intergenic
957676398 3:83372547-83372569 TGTCAGTGATTAGGGGAGGGGGG + Intergenic
957696106 3:83639550-83639572 TGTCATGGGGTAGGGGGAGGGGG + Intergenic
957732689 3:84161824-84161846 TGCCAGGGCTTGGGGGCCGGGGG - Intergenic
957765384 3:84617935-84617957 TGTCAGGGGTCAGGAACTGAGGG + Intergenic
957917338 3:86703437-86703459 TGTCAGGGGATGGGGGCTGGGGG - Intergenic
958031099 3:88111398-88111420 GGTGAGGGGTCAGGGGGTGGGGG - Intronic
958694022 3:97505334-97505356 TGTCGGGGGTGGGGGGCTAGGGG - Intronic
959019763 3:101175789-101175811 TGTCAGGGGTGGGGGGCCAGGGG + Intergenic
959059672 3:101604756-101604778 TGTCGGGGGTTGGGGGCTGGGGG - Intergenic
959127380 3:102306979-102307001 TGTCAGGGGTCAACTGCTGGGGG - Intronic
959203309 3:103275752-103275774 TGTCAGGGGATGGGGGCTAAAGG - Intergenic
959479941 3:106859052-106859074 TGTCAGGGGTTAGGAGGTAAGGG + Intergenic
959548153 3:107622100-107622122 TGCCAGGGGTTAGGGTTGGGAGG - Intronic
959630754 3:108504807-108504829 TGGCAGGGAGAAGGGGCTGGCGG + Intronic
959690917 3:109197284-109197306 TGTCAGGGGGTGGGGGCTAGGGG - Intergenic
959755283 3:109890026-109890048 TTCCAGGGGATAGGGGGTGGAGG - Intergenic
959825970 3:110796297-110796319 TGTCAGGGGTTAGGGATGGTGGG + Intergenic
959986351 3:112576549-112576571 TATCAGGGGTTAGGGTGAGGCGG - Intronic
960125607 3:113995173-113995195 TGCCAGGGGTTAGGGGCTGGCGG + Intronic
960714026 3:120558444-120558466 GGTCAGGGGTTTGGGGGAGGTGG + Intergenic
960734056 3:120758567-120758589 TGTCGGGGGTGGGAGGCTGGGGG - Intronic
960743608 3:120861882-120861904 TGTCGTGGGTTAGGGGTAGGGGG - Intergenic
960954158 3:123019741-123019763 TGTTATGGTTCAGGGGCTGGAGG + Intronic
961080412 3:124022286-124022308 TGTCAGGGGTTGGGGGGGCGAGG - Intergenic
961287366 3:125817237-125817259 TGTCAGGGCTTAGTGGGAGGAGG + Intergenic
961583969 3:127907004-127907026 TGTGAGGGGGTGGGGGCTAGGGG + Intergenic
961584676 3:127912481-127912503 AGTCAGGGCTTGGGGTCTGGAGG - Intergenic
961746055 3:129064170-129064192 TGTCGGGGGTTGGGGACTGAAGG - Intergenic
961899719 3:130198731-130198753 TGTCAGGGCTTAGTGGGAGGAGG - Intergenic
962019847 3:131487295-131487317 TGTCAGCGGTGAGGGGCTGGGGG + Intronic
962106828 3:132398879-132398901 TGTCAGGAGTTATGGGCAGGGGG - Intergenic
962108829 3:132420545-132420567 TGGCAGGGGGTTGGGGGTGGGGG - Intronic
962689848 3:137884135-137884157 TGTCAGTGGTGGGGGGCTAGTGG - Intergenic
963112351 3:141698022-141698044 TGGGAGGTGTTAAGGGCTGGGGG + Intergenic
963409784 3:144912514-144912536 TGTCAGGGGTGGGGGGCTAGGGG + Intergenic
963517321 3:146324716-146324738 TGTCAGCGGGTGGGGGCTAGGGG + Intergenic
963876876 3:150485720-150485742 TGACAGGGGGCAGGGGGTGGGGG - Intergenic
964369132 3:155981221-155981243 TGGCAGGGGTCGGGGGCGGGAGG + Intergenic
964371878 3:156008685-156008707 TGTCAGGGGGTAGGGGGCTGGGG - Intergenic
964560950 3:157995425-157995447 TGTCAGGGGGTAGGGGGCTGGGG + Intergenic
964725372 3:159809130-159809152 TGCGGGGGGTTGGGGGCTGGGGG - Intronic
964865427 3:161254305-161254327 TGCCAGGGGTTAGGGATGGGAGG - Intergenic
964878811 3:161400677-161400699 CGGCAGGGGTCGGGGGCTGGAGG - Intergenic
965428311 3:168554986-168555008 TGGCGGGGGTTAGGGAATGGTGG + Intergenic
965489531 3:169319419-169319441 TGTCAGGGGGTGGGGGGTAGGGG + Intronic
966487822 3:180490684-180490706 TGTCATGGGGTGGGGGGTGGGGG + Intergenic
967272560 3:187743458-187743480 TGGCTGGGGTTTGGGGGTGGGGG - Intronic
968095884 3:195930608-195930630 TGTCGGGGGTTGGGGGCAAGGGG - Intergenic
968358628 3:198130046-198130068 TGTCGGGGGTGGGAGGCTGGGGG - Intergenic
1202744657 3_GL000221v1_random:88414-88436 TGTTGGGGGTTGGGGGCGGGGGG - Intergenic
968565765 4:1311908-1311930 TGTCCTGGGTGTGGGGCTGGTGG + Intronic
968734200 4:2286784-2286806 CGGGAGGGGTGAGGGGCTGGAGG + Intronic
968828450 4:2916681-2916703 TGTCAGGGGTGTGGGGCTAGGGG - Intronic
968888970 4:3356535-3356557 TGCCAGGGGTTGGGGGTGGGGGG - Intronic
968901289 4:3433157-3433179 TTTCAGGGTTTAGGAGCTTGGGG + Intronic
968911970 4:3480996-3481018 TGTCAGAGGGTAAGGGGTGGAGG + Intronic
969010381 4:4056886-4056908 TGTCAGGGCTTAGTGGGAGGAGG - Intergenic
969245806 4:5932047-5932069 TGGCAGGGGTGGGGGGCGGGGGG - Intronic
969255420 4:5998526-5998548 TGCCAGGGCATAGAGGCTGGCGG + Intergenic
969291277 4:6241582-6241604 TGTCAGGGGACAGGGGCAGGGGG + Intergenic
969311049 4:6353436-6353458 TGTCGGGTGTTGGGGGCTGTTGG - Intronic
969340868 4:6540221-6540243 TACCAGGGGCTAGGGGCTTGGGG - Intronic
969482997 4:7456768-7456790 TGGCAGGGGTAGGGGGGTGGAGG + Intronic
969803075 4:9585101-9585123 TGTCAGGGCTTAGTGGGAGGAGG + Intergenic
970109646 4:12623375-12623397 TGTCAGGGGTGGGGGGCAGTGGG + Intergenic
970141235 4:12984354-12984376 TGTCAGGGGGTTGGGGCAAGGGG - Intergenic
970213946 4:13739280-13739302 TGTCAGGGGTTAGGGGGAAAGGG - Intergenic
970381487 4:15512536-15512558 TGTCAGAGGTTAGAGGAAGGAGG + Intronic
970775831 4:19672850-19672872 TGTCAAGGGTTGGGGGAAGGGGG + Intergenic
970952202 4:21770115-21770137 TGTTGGGGGTTAGGGGGTGAGGG - Intronic
971122620 4:23721043-23721065 TGTCGGGGGTGGGGGGCTAGGGG + Intergenic
971166483 4:24189129-24189151 TGCCAGGGGTTAGGGGTTGCAGG + Intergenic
971993666 4:33935039-33935061 TGTCGGGGGCTGGGGGCTAGGGG + Intergenic
972104920 4:35471606-35471628 TGTCAGGGGGTGGGGGTTAGGGG + Intergenic
972390773 4:38610894-38610916 TGACGGGGGTTGGGGGGTGGGGG - Intergenic
972468393 4:39380995-39381017 TGTCAGGGGTTGGGGGGTAAGGG - Intergenic
972715433 4:41641255-41641277 TGTCTGGGGATGGGGGTTGGCGG - Intronic
972797597 4:42437589-42437611 TATCGGGGGTTAGGGGCAGTGGG - Intronic
972890434 4:43551207-43551229 TGTCAAGGGAGAGGTGCTGGCGG + Intergenic
973101181 4:46273040-46273062 TGTCAGGGGTGGGGGGCTAGGGG - Intronic
973691171 4:53433949-53433971 GGTCAGGGGGTGGGGGCGGGTGG + Intronic
973752950 4:54041855-54041877 TGTCAGGGGTTGGGGGCTAGGGG + Intronic
973858167 4:55034081-55034103 TGTCAGGGGCTAAGGGCCAGGGG + Intergenic
973922040 4:55696784-55696806 TGTCATGGGGTAGGGGGTTGGGG + Intergenic
974045039 4:56891494-56891516 TGTCGGGGGGTGGGGGCTGGGGG + Intergenic
974128097 4:57720134-57720156 TGACAGAGGTTATGGGGTGGAGG - Intergenic
974263413 4:59554601-59554623 TGTTGGGGGTTGGGGGCTAGGGG - Intergenic
974361531 4:60887235-60887257 TGTCATGGGGTAGGGGGAGGGGG - Intergenic
974654906 4:64805769-64805791 TGTCGGGGGTTGGGGGCTGGTGG + Intergenic
975217871 4:71777881-71777903 TGTCGGGGGTTGAGGGCTAGGGG + Intronic
975368643 4:73557539-73557561 TGTCAGGGGGTGGGTACTGGGGG + Intergenic
975526098 4:75352308-75352330 TGTTGGGGGTTAGGGGGTGAGGG - Intergenic
975677065 4:76837378-76837400 TGTCAGGGGCTAGGAGGTTGTGG + Intergenic
975687653 4:76933398-76933420 TTTCATGTGTTAGGGTCTGGTGG - Intergenic
975998681 4:80345420-80345442 TGTCATGGGTTGGGGGGAGGGGG - Intronic
976007352 4:80445519-80445541 TGTCAGGGGTTGGGGGAAAGGGG + Intronic
976013526 4:80521618-80521640 TGTCAGGGGCTAGGGGAAAGGGG - Intronic
976197724 4:82549447-82549469 TGTCAGGGGCTAGGGGTAGGAGG + Intronic
976744553 4:88390242-88390264 TGCCAGGGGCTGGGGGTTGGGGG + Intronic
976822470 4:89222059-89222081 TGCCAGGGGTAAGGGAGTGGGGG - Intergenic
976865077 4:89715291-89715313 TGTCATGGGGTGGGGGATGGGGG + Intergenic
976975335 4:91160042-91160064 TGTCATGGGGTGGGGGCAGGGGG - Intronic
977002489 4:91521030-91521052 TGTCAGGGGCGGGGGTCTGGGGG - Intronic
977170318 4:93753489-93753511 TGTCATGGGGTAGGGGGAGGAGG - Intronic
977213411 4:94247687-94247709 TGCCAGGGGTTAGGGGGAGGAGG - Intronic
977457908 4:97284589-97284611 TGTCATGGGGTGGGGGCGGGGGG + Intronic
977837488 4:101662393-101662415 TGTCAGGGGTTAGGGGAGGGTGG + Intronic
977859394 4:101938084-101938106 TGTCAGGGGTGGGGGTCTAGGGG + Intronic
978103022 4:104866610-104866632 TGTCAGGGGTTAGTGGGAGTGGG - Intergenic
978364132 4:107962660-107962682 TGTCATGGGGTAGGGGGAGGGGG + Intergenic
978480270 4:109181856-109181878 TATCAAGGGCTAGGGGCAGGAGG - Intronic
978614740 4:110583253-110583275 TGCCAGGGGCTTGAGGCTGGGGG + Intergenic
978695725 4:111575778-111575800 TGTCGGGGATTAGGGGCTGGGGG - Intergenic
978845261 4:113266102-113266124 TGTCGGGGGTAGGGGGCTAGGGG - Intronic
978952047 4:114572696-114572718 GGACAGGGGCTAGGGGGTGGGGG - Intergenic
978989498 4:115061618-115061640 TGTCGGGGGTGAGGGGCAAGGGG + Intronic
979031619 4:115655323-115655345 TGTCAGGGGGTGGGGGCTGGGGG + Intergenic
979192814 4:117884344-117884366 TGTCTGGAGTGAGGGGCTAGAGG - Intergenic
979379186 4:119988171-119988193 TGTCAGGGGTCATGGGGAGGAGG + Intergenic
979381175 4:120008613-120008635 TGTCCTGGGTTTGGGGCAGGTGG + Intergenic
979554425 4:122028832-122028854 TGTCAGGGGTCGGGGGCTAGGGG - Intergenic
979578759 4:122329884-122329906 TGTCAGGGGTTAAGGGTCTGGGG - Intronic
979830351 4:125293011-125293033 TGTCAGGGGTTAAGGGGAAGGGG + Intergenic
979868153 4:125781693-125781715 TGTTGGGGGTTGGGGGGTGGGGG + Intergenic
980476939 4:133330501-133330523 TGTCAGGGGGTAGGGGGCTGGGG - Intergenic
980760075 4:137221383-137221405 TGCCAGGGGATAGGGGAGGGTGG + Intergenic
980954454 4:139414247-139414269 GGTCTGGGGTAAGGAGCTGGGGG + Intronic
981405947 4:144369257-144369279 GGTCAGGGAGTAGGGGCTTGGGG + Intergenic
981663063 4:147189874-147189896 TGTCAGGGGTTGGGGGTTAGGGG + Intergenic
981686252 4:147458128-147458150 TGTCAGGGGGTGGGGGCAAGGGG + Intergenic
981936478 4:150245513-150245535 TGTCATGGGGTAGGGGAAGGGGG - Intronic
982036889 4:151354715-151354737 TGTCAGGGGATGGGGGCAAGGGG - Intergenic
982796652 4:159654295-159654317 TGTCAGGGGTTGGGGGGTTAGGG - Intergenic
982812801 4:159847293-159847315 TGTCGGGGGTTGGGGGCTAGGGG - Intergenic
982834146 4:160102462-160102484 TGGCAGGGGCTAGGGGGTGGGGG - Intergenic
982943795 4:161592420-161592442 TCTCAGGGGTGGGGGGCTAGGGG - Intronic
982978011 4:162091463-162091485 TGTCTGGGGTTTTGGGGTGGGGG + Intronic
983457362 4:167982168-167982190 TGTCAGGGGGTGGGGGGAGGGGG - Intergenic
983467432 4:168112292-168112314 TGTCTGGGGTGGCGGGCTGGGGG + Intronic
983964669 4:173795245-173795267 TATCTGGGGTCAGGGGCTAGGGG - Intergenic
984032733 4:174625125-174625147 TGTCAGGGGGTAGGGGGCCGGGG - Intergenic
984182155 4:176497135-176497157 TGTAAGGGGATCGGGGCTAGGGG + Intergenic
984303241 4:177951613-177951635 TGGCAGGTGTTGGGGGGTGGAGG - Intronic
984317401 4:178144095-178144117 TGTCAGGGGTTAGAGGTGGGGGG + Intergenic
985471542 5:50240-50262 GGTCAGGGGTTAGGGTTTTGCGG - Intergenic
985640148 5:1059755-1059777 TGTCGGGGGGTGGGGGGTGGGGG + Intronic
985824951 5:2185080-2185102 GGTTAGGGGTTAGGGGTTTGGGG + Intergenic
985826868 5:2198843-2198865 TGTCAGGGGTTGGGGGCAAGGGG - Intergenic
985953960 5:3247959-3247981 TGTCGGGGGATGGGGGCTAGGGG - Intergenic
986220400 5:5763774-5763796 TGTCAGGAGTGAGGGCATGGAGG - Intergenic
986250011 5:6046676-6046698 AGGAAGGGGTTGGGGGCTGGGGG - Intergenic
986838266 5:11666913-11666935 TGTCAGGGGGTGGGGGCTGGGGG - Intronic
987051519 5:14150294-14150316 TGCCAGGAGTTAGGGGGTGGGGG + Intronic
987279178 5:16395144-16395166 TGTTGGGGGTGGGGGGCTGGGGG - Intergenic
987391063 5:17375884-17375906 TGTCAGGGGTGGGGGGCTGGGGG - Intergenic
987584528 5:19837254-19837276 TGTCTGGGGTTGGGGGCTAGGGG + Intronic
987653463 5:20775194-20775216 TGTCAGGGGTTAGGGGGCTAAGG - Intergenic
987723417 5:21666402-21666424 TGTCAGGGGATAGGAGGAGGAGG + Intergenic
987894570 5:23927483-23927505 TGTCGGGGGTTGGGGGCTAGGGG - Intergenic
988089208 5:26513841-26513863 TGTCACAGGTTGGGGGCTAGGGG - Intergenic
988373228 5:30400052-30400074 TGCCAGGGGCTAGGAACTGGAGG - Intergenic
988610263 5:32716999-32717021 TGTCAGGGGGTGGGGGGTGGGGG - Intronic
988742111 5:34086284-34086306 TGTCAGGGGTTAGGGGGCTAAGG + Intronic
989063260 5:37431717-37431739 TGCCAGGGGCTGGGGGCAGGAGG - Intronic
989089055 5:37710374-37710396 TGCCAGGGCTTAGGAGTTGGGGG - Intronic
989138774 5:38181667-38181689 TGTTGGGGGTGGGGGGCTGGGGG + Intergenic
989408604 5:41091103-41091125 TGTCAGGGGTGGGTGGCTGGGGG + Intergenic
989521910 5:42412457-42412479 TGTCATGGGGTAGGGGCATGGGG - Intergenic
989805575 5:45599404-45599426 TGTCAGGGGGTGGGGGCTGGGGG + Intronic
990109241 5:52303738-52303760 TGTCAGGGAGTGGGGGGTGGTGG + Intergenic
990147959 5:52784265-52784287 TCTCAGGTGTTAGGGGTAGGTGG - Intergenic
990183172 5:53185171-53185193 TATCAGGGGTGAGGGGGTAGGGG - Intergenic
990235572 5:53763737-53763759 TGTTGGGGGTGCGGGGCTGGGGG + Intergenic
990277723 5:54215788-54215810 AGTCAGGGGTGGGGGGCTGGGGG + Intronic
990456191 5:55990885-55990907 TGTCATGGGGTAGGGGGAGGGGG - Intronic
991424871 5:66480343-66480365 TGTCATGGGGTGGGGGATGGGGG - Intergenic
992140105 5:73787532-73787554 TGTCAGAGGGTAGGGGGTAGGGG - Intronic
992603175 5:78425941-78425963 TGTCAGGGGTGGGGGGCAAGGGG - Intronic
992603874 5:78435380-78435402 AATGAGGGGTTGGGGGCTGGAGG - Intronic
992668998 5:79039935-79039957 TGTGAGGGGTTAGGGGTGGGTGG - Intronic
992772636 5:80062680-80062702 TGTCATGGGGTAGGGGGAGGGGG - Intronic
992853921 5:80840740-80840762 TGTTAGGGGTAGGGGGCTGGGGG - Intronic
993008217 5:82451384-82451406 TGTCAGGGGGTCGGGGCTGGGGG - Intergenic
993011561 5:82489163-82489185 TGTCAGGGGGTGGGGGCTAGGGG - Intergenic
993296347 5:86146390-86146412 TGTCATGGGGTAGGGGGAGGGGG - Intergenic
993346122 5:86784831-86784853 TGCCAGGGCTGAGGGGCTGTGGG + Intergenic
993583440 5:89692855-89692877 TGGCTGGGGTAAGGGGCGGGCGG + Intergenic
994053790 5:95392348-95392370 TGTTGGGGGTTGGGGGCTAGAGG + Intronic
994108316 5:95971614-95971636 TGTTAGGGGTTAAGGGTGGGTGG - Intergenic
994418660 5:99505703-99505725 TGTCAGGGGTGGGGGGCTATGGG - Intergenic
994597266 5:101855112-101855134 TGTCGGGGGGTGGGGGCTAGGGG + Intergenic
994834507 5:104831898-104831920 TGTCAGGGGTTAGGGGGCTGGGG + Intergenic
994926901 5:106127363-106127385 TGCAAGGTGTTGGGGGCTGGGGG + Intergenic
995264388 5:110140333-110140355 AGTCGGGGGGTGGGGGCTGGGGG + Intergenic
995327546 5:110908082-110908104 TGTCATGGGGTAGGGGAGGGGGG + Intergenic
995489164 5:112671968-112671990 TGCCAGGGGTTGGGGGAAGGAGG - Intergenic
995580977 5:113601988-113602010 TGGCAGGGGTTAGGGGTCGGGGG - Intergenic
995586260 5:113651778-113651800 TGTTGAGGGTTGGGGGCTGGGGG + Intergenic
995640614 5:114252667-114252689 TGGCAGAGGTTGGGGGGTGGGGG - Intergenic
995692547 5:114843780-114843802 TGTCATGAGGTGGGGGCTGGGGG + Intergenic
995816275 5:116171823-116171845 TGTCACGGGTGTGGGGCTAGGGG + Intronic
995976276 5:118039132-118039154 TGTCGGGGGTGGGGGGCTAGGGG + Intergenic
995997001 5:118312563-118312585 TGTCAGGGGTGGGGGGCAAGGGG - Intergenic
996136795 5:119853019-119853041 TATCAGGGGTTATGGGATGGAGG - Intergenic
996242978 5:121225685-121225707 TGTCAGGGGTTAGGGGCCAAGGG + Intergenic
996580038 5:125021608-125021630 TGCCAGAGGTTAGGGGCGGGAGG + Intergenic
996668791 5:126091940-126091962 TGTCAGCGGGTGAGGGCTGGGGG + Intergenic
996852754 5:127970823-127970845 TGTGAAGGGTTAGAGACTGGAGG - Intergenic
996872874 5:128211440-128211462 TGCCAGGGGCTGGGGGGTGGGGG + Intergenic
996895141 5:128472344-128472366 TGGCAGGGGTTTGGGGTGGGAGG + Intronic
997068807 5:130594477-130594499 TGTCAGGGCGTGGGGGCTAGGGG + Intergenic
997097497 5:130929530-130929552 TGTCAGGGGGTGGGGGGTAGGGG + Intergenic
997112981 5:131095576-131095598 TGTCAGGGGTGGGGGGCAAGGGG - Intergenic
997205639 5:132047586-132047608 TACCAGGGGCTGGGGGCTGGGGG - Intergenic
997876502 5:137552835-137552857 TGTCAGGGGGTGGGGGCTAGGGG + Intronic
998040524 5:138948440-138948462 TGTGAGGGTTTGGGGGCTGGAGG - Intronic
998369042 5:141649593-141649615 GGTCAGGGGGCAGGGGGTGGGGG - Intronic
998663904 5:144273760-144273782 TGTCAGGGGCTGGGGGGAGGGGG + Intronic
998704731 5:144745648-144745670 TGTCAGGAGTGAGGGGCAAGGGG - Intergenic
998808653 5:145943320-145943342 AGCCAGGGGTTATGGACTGGGGG + Intronic
999079116 5:148826658-148826680 TGTCGGGTGCTAGGGGCTCGCGG - Exonic
999739251 5:154537427-154537449 TTCCAGGAGTTAGGGGCTAGGGG + Intergenic
999798025 5:155006292-155006314 TGTCAGAGGGTGGGGGCTAGGGG - Intergenic
999987230 5:157015314-157015336 TGTCAGGGGGTGGGGGCTTGGGG + Intergenic
1000213714 5:159134833-159134855 TGTTGGGGGTTGGGGGCTAGGGG + Intergenic
1000447759 5:161345039-161345061 TGTCTGGGGCTGGGGGCTAGGGG + Intronic
1000490426 5:161905901-161905923 TGTTGGGGGATGGGGGCTGGAGG + Intergenic
1001071844 5:168592693-168592715 TGTCATGGGGTAGGGGGAGGGGG - Intergenic
1001201906 5:169725652-169725674 TGTCGGGGGTTGGGGGCTGGGGG - Intronic
1001308720 5:170595168-170595190 TGTCTGGGGTTGGGGACTGGGGG + Intronic
1001746718 5:174098215-174098237 TGTCAGGGTGCTGGGGCTGGAGG + Intronic
1002117688 5:176976755-176976777 TGTCAAGGGCTAGGGGTTTGGGG + Intronic
1002394053 5:178939833-178939855 TGTTAGGGGTTAGGGTGTGATGG - Intergenic
1002415029 5:179115912-179115934 CTTCAGGGGTTTGGAGCTGGTGG - Intronic
1002686465 5:181014996-181015018 TGTCAGGGGTTAGGGAGCTGGGG + Intergenic
1002707012 5:181168496-181168518 TGTCAGGAGTTAGGAACTGGAGG + Intergenic
1002734253 5:181371750-181371772 TGTCTGGGGGTAGGGGCTGGGGG - Intergenic
1002750287 6:102375-102397 TGTCTGGGGGTAGGGGCTGGGGG + Intergenic
1002857149 6:1048056-1048078 GCTCAGGAGTTTGGGGCTGGAGG + Intergenic
1003405856 6:5826712-5826734 TACCAGGGGTTGGGGGTTGGGGG + Intergenic
1003594071 6:7459043-7459065 TGTCAGGGGCTAAGGGGAGGAGG - Intergenic
1003831018 6:10011572-10011594 TGTCTGAGGTTAGAGCCTGGTGG - Intronic
1004103585 6:12641783-12641805 TGTCAGGGGGTGGGGGGTGGGGG - Intergenic
1004478572 6:15997700-15997722 GGGTAGAGGTTAGGGGCTGGAGG + Intergenic
1004854837 6:19738658-19738680 TGTCAGGGGTTGGGGGCAAGGGG - Intergenic
1004924325 6:20403271-20403293 TGTCTGGGGTGAGGGGCTCGCGG + Intronic
1005242334 6:23845829-23845851 TGTCAGGGGATGGGGGCAAGGGG - Intergenic
1005253363 6:23972706-23972728 TGTCATGGGTGAGGGACTTGGGG - Intergenic
1005402009 6:25444519-25444541 TGTCGGGCGGTGGGGGCTGGGGG - Intronic
1005493592 6:26369471-26369493 TGTTAGGGGATTGGGGCCGGGGG + Intronic
1005670681 6:28103067-28103089 TGTCAGGGGATGGGGGCAAGGGG + Intergenic
1005958820 6:30682545-30682567 TGACAGGGGGTAGAGGGTGGAGG + Intronic
1006030176 6:31172114-31172136 TGTGAGGGGATTGGGACTGGGGG - Intronic
1006046028 6:31299255-31299277 TGTCAGGGGATGGGGGCAAGGGG - Intronic
1006135542 6:31893828-31893850 TGCCAGGGGCTAGGGGGTGGAGG + Intronic
1006144193 6:31948512-31948534 GGTCAGAGGTTAGGGAATGGTGG + Exonic
1006700465 6:35968785-35968807 TGCGGGGGGTAAGGGGCTGGGGG - Intronic
1007297515 6:40837394-40837416 AGTCAGGGGGTAGAGGATGGGGG - Intergenic
1007366731 6:41399344-41399366 AGGCATAGGTTAGGGGCTGGGGG - Intergenic
1007428198 6:41760581-41760603 CCTCAGGAGTTCGGGGCTGGTGG + Intergenic
1007662731 6:43496504-43496526 TGTCAGGGGGAGGAGGCTGGCGG + Intronic
1008513921 6:52301686-52301708 TACCAGGGGCTAGGGGCAGGGGG - Intergenic
1008812451 6:55520093-55520115 TGTCAGGGGGTGGGGGGCGGGGG + Intronic
1008963157 6:57287604-57287626 TGTCAGGGGGTGGGGGCAAGAGG + Intergenic
1009028094 6:58024018-58024040 TGTGTGGGGTTGGGGGCTAGGGG - Intergenic
1009203633 6:60775480-60775502 TGTGTGGGGTTGGGGGCTAGGGG - Intergenic
1009268579 6:61589062-61589084 TGTCAGGGGGTGGGGGTAGGGGG + Intergenic
1009597608 6:65755394-65755416 TGTCAGGGGTGGGGGGCTAGGGG + Intergenic
1009861542 6:69340760-69340782 TGTCAAGGGTGGGGGGCTAGAGG - Intronic
1009982670 6:70744319-70744341 TATCGGGGGTGTGGGGCTGGGGG - Intronic
1010004423 6:70980134-70980156 TGTCAAGGGGTGGAGGCTGGGGG + Intergenic
1010181473 6:73091317-73091339 TGTCAGGGGTTAGGGGGCTGGGG + Intronic
1010215778 6:73400152-73400174 TGGAAGGGGTTAGGGGCTTAGGG + Intronic
1010500222 6:76590309-76590331 TGGCAGGGGTTTGGGGGTGGGGG - Intergenic
1010669111 6:78665792-78665814 TGTCATGGGGTAGGGGGAGGGGG - Intergenic
1010886160 6:81243741-81243763 TGTCAGGGGTTAGGGGGCTACGG + Intergenic
1010994566 6:82518262-82518284 TGTCAGGGGTTGGTGGCTAGGGG + Intergenic
1011035290 6:82967476-82967498 TGCCAGGGGGTAGGGAGTGGAGG - Intronic
1011282923 6:85694943-85694965 TGTCATGGGGTAGGGGGAGGGGG - Intergenic
1011349816 6:86410247-86410269 TGTCATGGGGTGGGGGGTGGGGG - Intergenic
1011755376 6:90493709-90493731 TTCCAGGGGTTGGGGGCAGGAGG + Intergenic
1011988683 6:93483845-93483867 TGTCAGGGGTTCGGGGGTTATGG + Intergenic
1012056642 6:94420615-94420637 TGTTTGGGGTGAGGGGCTGGGGG + Intergenic
1012122044 6:95380829-95380851 TGTCAGGGAGTGGGGGCTAGGGG + Intergenic
1012491043 6:99782733-99782755 TGTCAGGGGTTTGGGGGTTTGGG - Intergenic
1012544867 6:100406985-100407007 TGTCAGGGCTTGGAGGGTGGGGG - Intronic
1012740649 6:103012684-103012706 TGTCAGGGGGTGAGGGGTGGGGG - Intergenic
1013191769 6:107809814-107809836 TGTGAGGGGTTAGGCACTTGAGG - Intronic
1013314655 6:108929950-108929972 TGGCAGGGGTTGGGGGTGGGGGG - Intronic
1013322314 6:109006444-109006466 TGTCGTGGGGTAGGGGGTGGGGG - Intronic
1013479643 6:110542984-110543006 GGTATGGGGTTGGGGGCTGGGGG + Intergenic
1013588128 6:111597427-111597449 AGACAGGGGTCTGGGGCTGGAGG - Intronic
1013605963 6:111748544-111748566 TCTCAAGGGTTAGGGGCCTGTGG + Intronic
1013998703 6:116340634-116340656 TGTCAGGGGGTGGGGGCTGGGGG - Intronic
1014186128 6:118436027-118436049 TGTCAGGGGTATGGAGCTAGGGG + Intergenic
1014649802 6:124022040-124022062 TGTCATGGGGTAGGGGGAGGGGG - Intronic
1015136427 6:129877436-129877458 TGTTGGGGGTTAGGGGGTGAGGG - Intergenic
1015214091 6:130730042-130730064 TGTCGGGGGTGAGGGACTAGGGG + Intergenic
1015248233 6:131099249-131099271 TGTTAGGGGTTGGGGGGTGAGGG - Intergenic
1015292463 6:131553240-131553262 TGTCAGAGGTTGGGGGCAAGGGG - Intergenic
1015622826 6:135150498-135150520 TGTTGGGGGTTGGGGGCTAGGGG - Intergenic
1015798948 6:137041958-137041980 TGTCGGGGGGTGGGGGCTAGGGG - Intronic
1016182114 6:141159817-141159839 TGCTAGGGGTTAGGGGCTGCGGG - Intergenic
1016320510 6:142839377-142839399 GGGCAGGGGTTGGGGGTTGGGGG + Intronic
1016698868 6:147031316-147031338 TGTCAGGGGGTAGGGGCCTAGGG + Intergenic
1017141592 6:151195789-151195811 TGTCAGGGGTTGGAGGATGGGGG + Intergenic
1017232121 6:152084267-152084289 TGTCAGGGGTTGGGGGGCTGGGG + Intronic
1017261575 6:152393972-152393994 TGTCAGGGGATGGGGGCTTAGGG - Intronic
1018306942 6:162467788-162467810 TGACAGGGGGTTGAGGCTGGAGG - Intronic
1018490904 6:164292344-164292366 TGTCATGGGGTAGGGGGAGGGGG - Intergenic
1018746297 6:166764708-166764730 TGTCAGGGGTTGCGGGCTCATGG - Intronic
1018749228 6:166788681-166788703 TGTCCGGGGTGAGGGGCAAGGGG + Intronic
1018909898 6:168095910-168095932 TGTTTGGGGTTGGGGGCCGGCGG + Intergenic
1019075204 6:169381380-169381402 TGTCAGGGTGTAGGGGGTGAGGG + Intergenic
1019193230 6:170266372-170266394 GGTCAAAGGTTGGGGGCTGGAGG + Intergenic
1019238503 6:170644065-170644087 TGTCTGGGGGTAGGGGCTGGGGG - Intergenic
1019729213 7:2621254-2621276 GGTCAGGGGTGTGTGGCTGGAGG - Intergenic
1019870419 7:3755672-3755694 TGTTTGGGGTGAGGGGTTGGGGG - Intronic
1019920091 7:4157838-4157860 TGGTAGGGGTGCGGGGCTGGCGG + Intronic
1020345656 7:7160330-7160352 TGGCAGGGATTAGGGGTTGGAGG - Intronic
1020609626 7:10378537-10378559 TGTCGGGGGGTGGGGGCTGGGGG + Intergenic
1020694647 7:11398381-11398403 TGTCGAGGGGTAGGGGCTAGGGG + Intronic
1020870749 7:13625658-13625680 TGTCATGGGATTGGGGGTGGGGG + Intergenic
1020973942 7:14982457-14982479 TGTCGGGGGATGGGGGCTAGGGG - Intergenic
1021049624 7:15966496-15966518 TGTCAGGGGGTAGGGGGTCTAGG + Intergenic
1021148043 7:17113787-17113809 TGTCGGGGGTTGGGGGCTAAGGG - Intergenic
1021171692 7:17405091-17405113 TGTCGGGGGCTGGGGGCTAGGGG + Intergenic
1021480491 7:21110284-21110306 TGTCAGGGGTTTGGGGCCCAGGG + Intergenic
1021771691 7:24009114-24009136 TGTCAGGGGATGGGGGGTGGGGG - Intergenic
1022062998 7:26819412-26819434 TGTCGGGGGGTGGGGGCTAGGGG + Intronic
1022503732 7:30897828-30897850 TGTCAGGGGCAAGGGGCCTGGGG + Intergenic
1022621097 7:31985567-31985589 TGTCGGGGGCTGGGGGTTGGGGG - Intronic
1022868365 7:34446865-34446887 TGTCAGGGGTGAGGGGCTAGCGG + Intergenic
1023280815 7:38567383-38567405 TGTCAGGGGTTGGGGGCTGGGGG + Intronic
1023367695 7:39480161-39480183 TGTCGGGGTGTGGGGGCTGGGGG + Intronic
1023450922 7:40284128-40284150 TGCCAGGGGCTGGGGGTTGGAGG + Intronic
1023709607 7:42977663-42977685 TGTCAGGGGTTAAGGGTTGTGGG - Intergenic
1023719073 7:43074194-43074216 TGTCAGGGGGTGCGGGCTAGGGG + Intergenic
1023819660 7:43973461-43973483 TGTCAGGGGGTAGTGATTGGTGG - Intergenic
1023843367 7:44108585-44108607 TGCCTGGGGTTGCGGGCTGGGGG - Intronic
1024066112 7:45738049-45738071 TGTCAGGGGTGGAGGGCTGGGGG + Intergenic
1024347917 7:48331904-48331926 TGGCAGGGGTCAGGGACTTGCGG - Intronic
1024558898 7:50627469-50627491 TGTGAGGGGTGAGGTGCTGCGGG - Intronic
1024680177 7:51678228-51678250 TGTCCAGGGGTGGGGGCTGGGGG + Intergenic
1026034775 7:66823165-66823187 TGTCCTGGGCCAGGGGCTGGTGG - Intergenic
1026067868 7:67091409-67091431 TGTCATGGGTTGGGGGGAGGGGG + Intronic
1026709064 7:72720894-72720916 TGTCATGGGTTGGGGGGAGGGGG - Intronic
1026827946 7:73595770-73595792 GGGCAGGGGTCAGGGGCTGGGGG + Intronic
1027836541 7:83251216-83251238 TGCCAGGGGTTAGGGGGAAGGGG - Intergenic
1027973788 7:85122082-85122104 TGTTGGGGGCTGGGGGCTGGGGG + Intronic
1028144855 7:87310388-87310410 TGTCAGGGGGTGGGGGCCAGGGG + Intergenic
1028366291 7:90036544-90036566 TGTCAGGGGTGGGGGTCTAGGGG + Intergenic
1028552389 7:92083972-92083994 TGTCGGGGGTGAGGTGCTAGGGG - Intronic
1028736742 7:94221820-94221842 TGTCAGGGGGTAGGGGGCTGGGG + Intergenic
1028746079 7:94328184-94328206 TGTCAGGGGGTGGGGGCTAAGGG + Intergenic
1028757506 7:94454644-94454666 TGTCAGGGGTGGGAGGCTAGGGG - Intergenic
1028782358 7:94751758-94751780 TGTCAGGGGTGGGGAGCTAGGGG - Intergenic
1029069666 7:97884887-97884909 TGTCAGGGCTTAGTGGGAGGAGG - Intergenic
1029133816 7:98354474-98354496 TGTCGGGGGTTAGGGAAAGGTGG - Intronic
1029292436 7:99512514-99512536 GGTCAGGGGATGGGGGCTGCAGG - Exonic
1029679189 7:102096261-102096283 AGTCAGGGGTTAGCGGCCGCAGG - Intronic
1029744709 7:102510430-102510452 TGTCAGGGGGTAGTGATTGGTGG - Intronic
1029762700 7:102609592-102609614 TGTCAGGGGGTAGTGATTGGTGG - Intronic
1030186064 7:106763195-106763217 TGTCAGGGGGTGGGGGCTAGGGG + Intergenic
1030347556 7:108451778-108451800 TGCCAGGGGCTGGGGGCTGAGGG + Intronic
1030350572 7:108480897-108480919 TGTCAAGGGTTATGGGTGGGAGG - Intronic
1030391742 7:108936950-108936972 TGCCAGGGACTAGGGGGTGGGGG + Intergenic
1030399564 7:109031635-109031657 TGTCAGGGGTTTGGGGGTTAGGG - Intergenic
1030462964 7:109863487-109863509 TGTCAGGGGGTAGGGGGCTGGGG + Intergenic
1030534588 7:110749741-110749763 TGTCAGGGGTTGGGGGCCCAGGG + Intronic
1030876013 7:114814361-114814383 AGTGAGGAGTTAGGGGCTGGAGG - Intergenic
1030940005 7:115634203-115634225 TATCGGGGGTGAGGGGCTAGGGG + Intergenic
1031078783 7:117238764-117238786 TGTCGGAGGTGGGGGGCTGGGGG - Intergenic
1031268438 7:119612348-119612370 TGTCGGGGGTGGGGGGCTAGAGG + Intergenic
1031641628 7:124171841-124171863 TGTTGGGGGGTGGGGGCTGGGGG - Intergenic
1031717093 7:125123099-125123121 TGTCGGGGGTTAGGGGGAAGGGG - Intergenic
1032176621 7:129634351-129634373 TGTCAGGGGTTAGAGAAAGGAGG - Intronic
1032250088 7:130248852-130248874 TGTCAGGGGGTGGGGGCTGGGGG - Intergenic
1032471755 7:132184157-132184179 TCTCAGGGGTGTGGGGCTGGGGG - Intronic
1032587816 7:133163829-133163851 TGGCAGGGGTGAGGGGATTGGGG + Intergenic
1032625923 7:133591054-133591076 TGTGAGGGGTTGAGGGCTGTGGG + Intronic
1032925324 7:136598132-136598154 TGTCGGGGGTTGGGGGCTAGGGG - Intergenic
1033094441 7:138418399-138418421 TGTCATGGGGTCGGGGGTGGGGG - Intergenic
1033432527 7:141301979-141302001 TGCCAGGGGTTGGGGGAAGGAGG + Intronic
1033517124 7:142118170-142118192 TGTCAGGAGTTAGGGGGAAGAGG - Intronic
1033546521 7:142406104-142406126 ATTCAGGGGATAGAGGCTGGTGG - Intergenic
1033951563 7:146791065-146791087 TGTCAGGGGGTAGGGGCTGGGGG - Intronic
1034138396 7:148793462-148793484 TGTCAGGGGCTGGGAGCTAGCGG - Intronic
1034208370 7:149339556-149339578 TGTCATGGGGTGGGGACTGGGGG - Intergenic
1034456754 7:151174794-151174816 GGACAGGGGTTGGGGCCTGGAGG - Intergenic
1034550595 7:151818300-151818322 ATTCAGGGGTTGGGGGGTGGGGG - Intronic
1034594324 7:152175463-152175485 TGTCGGGGGTGGGGGGCTAGGGG - Intronic
1034862586 7:154612319-154612341 TGTCAGGGGTTAGGGAGGGAAGG - Intronic
1035039230 7:155915503-155915525 TTTCAGTGGTTCGGTGCTGGAGG - Intergenic
1035261732 7:157665979-157666001 TGTCAGGGGCTGGGGGCCAGGGG + Intronic
1035408643 7:158619091-158619113 TGCCAGGGGCTAGGGGACGGAGG + Intergenic
1035509265 8:162542-162564 TGTCTGGGGGTAGGGGCTAGGGG + Intergenic
1035514432 8:220524-220546 GGTTAGGGGTTAGGGGTTAGGGG - Intergenic
1035514435 8:220531-220553 GGTTAGGGGTTAGGGGTTAGGGG - Intergenic
1035616527 8:1006215-1006237 TTTCAGGGGTTGGGGGATGGTGG - Intergenic
1035692238 8:1567877-1567899 GGTCAGGTGTTAAGGGCTGTTGG - Intronic
1036207892 8:6818792-6818814 TGGCAGGGGCTGGGGGCTGGGGG - Intronic
1036251912 8:7169555-7169577 TGTCAGGGCTTAGTGGGAGGAGG - Intergenic
1036365579 8:8117906-8117928 TGTCAGGGCTTAGTGGGAGGAGG + Intergenic
1036450463 8:8862557-8862579 TGTCTGCTGTTAGGGGGTGGAGG + Intronic
1036762114 8:11516596-11516618 TAACAGGTGTCAGGGGCTGGGGG - Intronic
1036812583 8:11877709-11877731 TGACTGGGGTTAGGGGTTGCAGG + Intergenic
1036885368 8:12548200-12548222 TGTCAGGGCTTAGTGGGAGGAGG - Intergenic
1036925739 8:12903717-12903739 TGTCGGGGGTTGGGGGCAAGGGG - Intergenic
1036931314 8:12958939-12958961 TGTCAGGGGTCGGGGGCTGTGGG + Intronic
1036985097 8:13520468-13520490 TGTAGGGGGTTGGGGGCTAGGGG + Intergenic
1037003833 8:13752201-13752223 TGTAAAGAGTCAGGGGCTGGAGG - Intergenic
1037412454 8:18613162-18613184 CGTCAGGTGTTGGGGGCAGGAGG - Intronic
1037489050 8:19379179-19379201 TGCCAGGGGCTGGGGGTTGGTGG - Intronic
1037687879 8:21159075-21159097 TGGCAGGGTCTAGAGGCTGGGGG + Intergenic
1037708392 8:21334841-21334863 TGTTGGGGGGTGGGGGCTGGGGG + Intergenic
1038553536 8:28490266-28490288 TGGGAGGGGTGAGGGACTGGAGG - Exonic
1038635857 8:29286656-29286678 TGGCTGAGGTTGGGGGCTGGTGG + Intergenic
1039193093 8:34999147-34999169 TGTCAGAGGGTGGGGGCTAGGGG + Intergenic
1039320993 8:36430943-36430965 TGTCATGGGAGAGGGGCTAGTGG - Intergenic
1039911098 8:41827964-41827986 TGTCGGGGGTTGGGGGGCGGGGG - Intronic
1040088001 8:43365560-43365582 GGTCAAGGGTGAGGTGCTGGTGG - Intergenic
1040501009 8:48005164-48005186 TGTCAGGGGTTGGGGGCTAGGGG - Intergenic
1040540359 8:48348044-48348066 GCTCAGGGGTAAGGTGCTGGTGG - Intergenic
1040552743 8:48450923-48450945 TGTCAGCAGGTGGGGGCTGGGGG + Intergenic
1040557241 8:48491518-48491540 TGTCAGGGGTTGGGGGGCAGGGG + Intergenic
1040730059 8:50434035-50434057 TGTCATGGGGTAGGGGGAGGGGG - Intronic
1041094222 8:54333177-54333199 TGGCAGGGCCTAGGTGCTGGTGG + Intergenic
1041222213 8:55663345-55663367 TGTCAGGGGGTAGGGGGTTGGGG - Intergenic
1041634223 8:60124815-60124837 TGTCAGGGTTGGGCGGCTGGGGG - Intergenic
1041815349 8:61964466-61964488 TGTCGGGGGGTAGGGGGTCGGGG - Intergenic
1042141170 8:65680161-65680183 TCTCAGGGGTTGGGGGGCGGGGG + Intronic
1042349527 8:67762785-67762807 TGTCAGGGGCTGGGGTCTAGGGG + Intergenic
1042462904 8:69091603-69091625 TGTCATGGGTTGGGGGCTAGGGG - Intergenic
1042697475 8:71571347-71571369 TGTCAGGGGGTGGGGGGTCGGGG + Intronic
1042905711 8:73769666-73769688 TGTCAGGGGTTGGGGTAGGGAGG - Intronic
1042955552 8:74246333-74246355 TGTCTGGGGTGAAGGGTTGGGGG - Intronic
1043031626 8:75141024-75141046 TGTCCGGGGGTTGGGGCTCGGGG + Intergenic
1043339940 8:79225575-79225597 TGTCAGGGTTGGAGGGCTGGGGG + Intergenic
1043342847 8:79261798-79261820 TGTCGGCGGGTGGGGGCTGGGGG + Intergenic
1043497785 8:80822267-80822289 TGTCATGGGTTGGGGGCGGGGGG - Intronic
1043535455 8:81199428-81199450 TGTCATGGGTTTGGGGGAGGGGG - Intergenic
1043598097 8:81907180-81907202 TGTCGGGGGTAGGGGGCTGGGGG + Intergenic
1043734659 8:83728319-83728341 TGTTGGGGGTTGGGGGCTAGGGG + Intergenic
1043925142 8:86028204-86028226 TGTGAAGGGGTAGGGGCAGGTGG - Intronic
1043977198 8:86597021-86597043 TGTCGGGGGTGGGGGTCTGGGGG + Intronic
1043998180 8:86844697-86844719 TGTTAGGGGGTGGGGACTGGGGG - Intergenic
1044283326 8:90381425-90381447 TGTCATGGGGTGGGGGCAGGGGG + Intergenic
1044767681 8:95594034-95594056 TGTCAGGGGTTGGGGACTATGGG - Intergenic
1044856354 8:96480013-96480035 TGCCAGGGGTTGGGGGAAGGAGG + Intergenic
1044950336 8:97429783-97429805 TGTCACGGGTTGGGGGAAGGGGG + Intergenic
1045527911 8:102957209-102957231 TGTCATGGGGTGGGGGGTGGGGG - Intronic
1045656821 8:104395471-104395493 TGCCAGGTGTTAGGGATTGGGGG - Intronic
1045704924 8:104911358-104911380 TGTCAGGGGTGAGGGACGAGGGG - Intronic
1046218348 8:111179834-111179856 TGTCATGGGGTAGGGGAAGGGGG - Intergenic
1046301679 8:112301738-112301760 TTTCAAGGGTGAGGGGCAGGGGG + Intronic
1046306918 8:112379958-112379980 TGTCAGGGGATAGGGAGAGGGGG + Intronic
1046401708 8:113713107-113713129 TGTCAGGGTATGGGGGCTAGGGG + Intergenic
1046513666 8:115230393-115230415 TGTCAGGTGGTGGGGGCTAGGGG + Intergenic
1047150935 8:122262095-122262117 TTGCAGGGGTTGGGGGCTAGGGG - Intergenic
1047174654 8:122529060-122529082 TGTCATGGGGTGGGGGCTAGGGG - Intergenic
1047253683 8:123199889-123199911 TGTTAAGGGTTGAGGGCTGGGGG - Intronic
1047777873 8:128088443-128088465 GGGCAGGGGTTGGGGGATGGAGG + Intergenic
1048088245 8:131208399-131208421 TGTGAGGGGTTGGGGGCTAGGGG - Intergenic
1048394331 8:133999474-133999496 TTCCAGGGGTTAGGGGGTGAGGG + Intergenic
1048442669 8:134471454-134471476 AGTCAGGGGTTTGGGGTTGGAGG - Intergenic
1048641603 8:136369786-136369808 TGTGAGGGGTTGAGGGCTGTGGG - Intergenic
1048943697 8:139425409-139425431 TGCCAGGGGTTAGAGGCAGGGGG + Intergenic
1049030925 8:140036991-140037013 TGTCGGGGGTGGGGGGCTAGGGG - Intronic
1049255019 8:141609141-141609163 TGGCAGGGGGTGGGGGCTGGGGG + Intergenic
1049357225 8:142194954-142194976 CGTCAGGGGTCAGAGGTTGGAGG + Intergenic
1049641650 8:143718730-143718752 AGTCGGGGGTGGGGGGCTGGGGG - Intronic
1049709746 8:144058150-144058172 TGGCAGGGGTGGGGTGCTGGTGG + Intronic
1049882835 9:10160-10182 GGTTAGGGGTTAGGGGTTAGGGG - Intergenic
1049882838 9:10167-10189 GGTTAGGGGTTAGGGGTTAGGGG - Intergenic
1049882861 9:10230-10252 GGTTAGGGGTTAGGGGTTAGGGG - Intergenic
1050059092 9:1687081-1687103 TGTGAGGGGTTAAGAGCTGCAGG - Intergenic
1050074335 9:1847796-1847818 TTTCAGGGGTTAGGGGGCTGGGG + Intergenic
1050141029 9:2515778-2515800 TGTCAGGGGTGTGGGGCTAGGGG - Intergenic
1050161466 9:2724021-2724043 TGCCGGGGGTTGGGGGGTGGAGG + Intronic
1050365872 9:4873375-4873397 TGCCAGGTGTTCGGGGCTAGAGG - Intronic
1050897610 9:10902676-10902698 TGTCAGGGGGTGGGGGCTGGGGG + Intergenic
1051051060 9:12931695-12931717 TGTCAGGTGTCTGGGGCAGGAGG - Intergenic
1051753192 9:20366194-20366216 TTTCAGGGGTCAGGGGCTAGGGG - Intronic
1052030873 9:23627292-23627314 TGTCGAGGGTTGGGGGCTGGGGG + Intergenic
1052118363 9:24676684-24676706 TGTCAGGGGTGGGGAGCTAGGGG + Intergenic
1052206605 9:25848711-25848733 TGTGTGGGGTTGGGGGGTGGGGG - Intergenic
1052270448 9:26622898-26622920 TGTCGGGGGGTAGGGGCTAAGGG + Intergenic
1052317134 9:27127123-27127145 TGTCAGGGGATTGGGGGTTGAGG - Intronic
1052355566 9:27501595-27501617 TGTCATGGGGTGGGGGGTGGGGG + Intronic
1052381732 9:27779004-27779026 TGTCAGGGGGTGGGGGCTAGGGG - Intergenic
1052604538 9:30682070-30682092 TGTCATGGGTTGGGGGAGGGGGG + Intergenic
1052718243 9:32144885-32144907 TGTTGGGGGTAGGGGGCTGGGGG - Intergenic
1053000564 9:34575206-34575228 GGACTGGGGTTGGGGGCTGGGGG - Intronic
1053620110 9:39806458-39806480 TGTCAGGGGTTGAGGGAAGGAGG + Intergenic
1053626587 9:39877484-39877506 TGTCAGGGGTTGAGGGAAGGAGG - Intergenic
1053753058 9:41274874-41274896 TGTTAGGGGTTAGGGATTAGGGG + Intergenic
1053878282 9:42565760-42565782 TGTCAGGGGTTGAGGGAAGGAGG + Intergenic
1053894379 9:42728607-42728629 TGTCAGGGGTTGAGGGAAGGAGG - Intergenic
1054217300 9:62373219-62373241 TGTCAGGGGTTGAGGGAAGGAGG + Intergenic
1054233411 9:62535934-62535956 TGTCAGGGGTTGAGGGAAGGAGG - Intergenic
1054258588 9:62839249-62839271 TGTTAGGGGTTAGGGATTAGGGG + Intergenic
1054264046 9:62900986-62901008 TGTCAGGGGTTGAGGGAAGGAGG - Intergenic
1054333190 9:63780818-63780840 TGTTAGGGGTTAGGGATTAGGGG - Intergenic
1054805828 9:69395200-69395222 TGTCAGGAGTTAGGGGAGAGAGG - Intergenic
1055318722 9:75060403-75060425 TGTCGGGGGTGGGGGGCTGGGGG + Intergenic
1055390437 9:75816317-75816339 TGTCGGGGGTTGGGGGATAGTGG - Intergenic
1055652267 9:78417930-78417952 AGCAAGGGGTTAGGGGTTGGGGG + Intergenic
1055652271 9:78417937-78417959 GGTTAGGGGTTGGGGGATGGGGG + Intergenic
1055705445 9:78995607-78995629 TGGCTGGGGTAAGGGGCTGCTGG - Intergenic
1055754254 9:79540511-79540533 TGTCAGGGGATGGGGGCAAGGGG + Intergenic
1056175960 9:84036314-84036336 TGTCAGGGGGTGGGGGCCTGGGG - Intergenic
1056375563 9:86006624-86006646 TGCCAGGGGTTTGGGGCGGGAGG + Intronic
1056837523 9:89968962-89968984 GGTCTGTGGTTAGGGGCAGGTGG + Intergenic
1056888028 9:90462734-90462756 TGTCAGGGAGTGGGGGCTAGGGG + Intergenic
1056971315 9:91206972-91206994 TGCCAGGGGCTTGGGGGTGGAGG + Intergenic
1057017884 9:91669781-91669803 TGTCAGGGGATGGGGGGTGAGGG - Intronic
1058063565 9:100524886-100524908 TGCCAGGGGTGGGGGTCTGGGGG - Intronic
1058081409 9:100704626-100704648 TGTCAGGGGGTGCGGTCTGGGGG - Intergenic
1058131880 9:101262999-101263021 TGTCAGTGGGTAGGGGCCTGGGG + Intronic
1058507972 9:105685927-105685949 TGTCGGGGGTGGGGGGCTAGGGG + Intergenic
1059253105 9:112904878-112904900 TGTGAGGGGTAAGGGACTGCTGG + Intergenic
1059285979 9:113171994-113172016 TGTCGGGGGTTGGGGGACGGGGG - Intronic
1059495150 9:114703134-114703156 TGTCTGTGGTCAGGTGCTGGTGG + Intergenic
1059683937 9:116615720-116615742 TGTCATGGGGTGGGGGCAGGGGG + Intronic
1059875008 9:118625085-118625107 TGTCAGGGGTTAGGGGGCAAGGG - Intergenic
1059965127 9:119606251-119606273 TGTCAGGGGTGGGGGGCTGGGGG - Intergenic
1060037534 9:120269894-120269916 TGTCATGGGGTGGGGGCTGGGGG - Intergenic
1060555710 9:124506366-124506388 TCTCAGGGGTTTGGGGGTGCGGG - Intronic
1061314634 9:129787260-129787282 TGTGATCGGTTTGGGGCTGGAGG + Intergenic
1061708777 9:132473097-132473119 AGTCAGGGGTTGGGGGAGGGAGG + Intronic
1061831985 9:133301993-133302015 TGTCAGTGGGTAGAGGCTGGAGG - Intergenic
1061938914 9:133873708-133873730 AGTCGGGGGTCAGGGGCTGTTGG + Intronic
1061961335 9:133990782-133990804 TGTCAGTGGTCAGGTGCAGGTGG - Intronic
1062049316 9:134438881-134438903 TTTCAGGGGTTGGCGGCCGGGGG - Intronic
1062280479 9:135749552-135749574 TGTCAGGGAAGATGGGCTGGTGG - Intronic
1062610214 9:137370108-137370130 TGACAGGGGTGGGGGGCTGGGGG + Intronic
1062723603 9:138058588-138058610 TGTCAGGGGTTTGGCGCTGATGG - Exonic
1062758706 9:138324357-138324379 TGTCTGGGGGTAGGGGCTAGGGG - Intergenic
1203713285 Un_KI270742v1:118364-118386 TGTTGGGGGTTGGGGGCGGGGGG - Intergenic
1185441286 X:229301-229323 TGGTAGGGGTTGGGAGCTGGGGG + Intergenic
1185511860 X:669736-669758 GGTGAGGGGCTAGGGGATGGAGG + Intergenic
1185672329 X:1823027-1823049 TGTCAGGGGAGGGGGGCTAGGGG + Intergenic
1185741323 X:2535025-2535047 TGTCAGGGGGTGGGGGCCTGGGG + Intergenic
1185947535 X:4394654-4394676 TGTCAGGGGTTGGGGGGCTGGGG - Intergenic
1185987736 X:4854652-4854674 TATCAGGGGCTGGGGACTGGGGG + Intergenic
1186299382 X:8183026-8183048 TGTCAGGGGGGAGGGGGTTGCGG - Intergenic
1186347508 X:8709108-8709130 TGTCAGGGGGTGGGGGGTGAGGG + Intronic
1186681683 X:11881626-11881648 TGCCAAGGATTAGGGGTTGGAGG + Intergenic
1186991032 X:15068067-15068089 TGTCAGGGGGTAGGGGGAGGGGG + Intergenic
1187144047 X:16621298-16621320 TGTCGGGGGGTAGGGGGTTGGGG + Intronic
1187280249 X:17853038-17853060 TGACAGTGGGGAGGGGCTGGGGG + Intronic
1187291365 X:17956857-17956879 TGCCAGGGGTTGGGGGTGGGAGG - Intergenic
1187597232 X:20786205-20786227 TGTCAGGGTTGGGGGGCTAGGGG - Intergenic
1187731600 X:22260712-22260734 TGTCGGGGGTGGGGGGCTAGGGG + Intergenic
1188280590 X:28263180-28263202 TGTCGGGGGTGGGGGGCTAGGGG - Intergenic
1188320543 X:28731763-28731785 TGTCTGGGGTTAGGAGGTAGGGG - Intronic
1189187720 X:39068638-39068660 TGTTGGGGGTTGGGGTCTGGGGG - Intergenic
1189892161 X:45614474-45614496 TGCCAGGGGTTAGGGGTTAAGGG + Intergenic
1189902698 X:45723476-45723498 TGCCTGGGGTTAGGGGTTGGAGG - Intergenic
1189909165 X:45792703-45792725 TGGGAGGGGTGAGGGGGTGGGGG - Intergenic
1189977490 X:46477264-46477286 TGTCGGGGGGCAGGGGGTGGGGG + Intronic
1190624845 X:52327200-52327222 TGTCGGGGGGTGGGGTCTGGGGG - Intergenic
1190943399 X:55067201-55067223 TGTCAGGGGTGGGGGGCTAGGGG - Intergenic
1191073174 X:56424205-56424227 TGTCAGGGGGTGGGGGCCTGGGG - Intergenic
1191093210 X:56646525-56646547 TGTTGTGGGGTAGGGGCTGGGGG - Intergenic
1191134913 X:57053263-57053285 TGTCGGGGGTGAGGGGCTAGGGG + Intergenic
1191139434 X:57100596-57100618 TGTCAGGGGTGGGGGGCTAGGGG + Intergenic
1191207267 X:57848196-57848218 TGTCAGGTTGTAGGGGCTGGGGG + Intergenic
1191677182 X:63803745-63803767 TGCTGGGGGTTGGGGGCTGGGGG + Intergenic
1191705630 X:64091593-64091615 TTTCAGGGGGTGGGGGCTAGGGG + Intergenic
1191777657 X:64834219-64834241 TGTCAAGGGGTGGGGGCTAGGGG - Intergenic
1191874489 X:65781328-65781350 TGTCAGGATGTGGGGGCTGGGGG + Intergenic
1191970146 X:66804880-66804902 TGTCAGGGGGTGGGGTCTAGAGG + Intergenic
1192253452 X:69433869-69433891 TGTCATGGGGTGGGGGCAGGGGG - Intergenic
1192369562 X:70502045-70502067 TGTGAGGGGTGAGGGGGTGGAGG + Intronic
1192440685 X:71171328-71171350 TGTGCGGGGTTGGGGGTTGGGGG + Intergenic
1192558174 X:72106959-72106981 TGTCGGGGGGTGGGGGCTGGGGG + Intergenic
1192798477 X:74444004-74444026 TGTCTGGGGGCAGGGGCAGGAGG + Intronic
1192970618 X:76225236-76225258 TGTCATGGGGTGGGGGTTGGGGG - Intergenic
1192975312 X:76277627-76277649 TGTCGGGGGTCAGGGGCTAGGGG - Intergenic
1192982739 X:76364501-76364523 TGTCGGGGGGTGGGGGCTAGGGG - Intergenic
1193243525 X:79201271-79201293 TGTTAGGGGTTGGGGGCTAGGGG + Intergenic
1193572150 X:83157154-83157176 TGTCAGGGGGTGGGGGATGAGGG + Intergenic
1193613145 X:83656274-83656296 TGTCAGGGGGTAGGGGCCTAGGG - Intergenic
1193615469 X:83683073-83683095 TGTCGGGGGTGGGGGGCTAGGGG - Intergenic
1193687873 X:84600662-84600684 TGTCAGGGGGTGGGGGCTAGGGG + Intergenic
1193812176 X:86064666-86064688 TGCCAGGAGTTAAGGGGTGGGGG - Intergenic
1193845093 X:86458865-86458887 TGTCAGGGGGTGGAGGCTAGGGG + Intronic
1194022176 X:88704328-88704350 TGTTAGGGGATGGGGGCTGAGGG + Intergenic
1194030359 X:88805652-88805674 TGTCAGGGGTTGGGGGCAAGGGG + Intergenic
1194102143 X:89718853-89718875 TGTCAGGGGTTAGGGGGATAGGG - Intergenic
1194376181 X:93136511-93136533 TGTCGGGGGTTGGGGGCAAGGGG + Intergenic
1194509855 X:94780391-94780413 TGTCAGGGGCTGGGGACTAGAGG + Intergenic
1194852498 X:98886770-98886792 TGTCAGGGGATGGGGGGTGAGGG + Intergenic
1195008211 X:100708070-100708092 TGTCGGGGGTGGGGGGCTAGGGG + Intronic
1195252395 X:103062033-103062055 TGTCATGGGCTGGGGGCAGGTGG + Intergenic
1195299349 X:103511692-103511714 TGTTAGGGGGTGGGGGCTAGGGG + Intronic
1195332678 X:103817425-103817447 TGTCAAGGGTTGGGGGCTAGGGG + Intergenic
1195334020 X:103832014-103832036 GAACAGGGGCTAGGGGCTGGAGG - Intronic
1195347915 X:103969384-103969406 TGTCAGGGGTTAGGGGCAAAGGG - Intergenic
1195359527 X:104069457-104069479 TGTCAGGGGTTAGGGGCAAAGGG + Intergenic
1195529157 X:105932007-105932029 TATCAGGGGTTAGAGGAGGGGGG - Intronic
1195826505 X:109006752-109006774 TGTCAGGGGTTGGGGGGAAGGGG + Intergenic
1195955760 X:110328612-110328634 TGTCAGGGGGTGGGGGCCTGGGG - Intronic
1196019644 X:110976953-110976975 TGTCAGGGGTTGGGGGGCTGGGG + Intronic
1196243747 X:113373784-113373806 TGTCAGGGGTGGGGGCCTGGGGG + Intergenic
1196361723 X:114868987-114869009 TGTCAGGGGTTGGGGGGCTGGGG - Intronic
1196689206 X:118541274-118541296 TTGCAGGGGTCAAGGGCTGGTGG + Intronic
1196979209 X:121193177-121193199 TGTCAGGGGGTAGGGGGCTGGGG - Intergenic
1197107034 X:122729088-122729110 TGTCGTGGGGTAGGGGCAGGGGG + Intergenic
1197113636 X:122805306-122805328 TGTCAGGGGTGGGGGGCTTGGGG + Intergenic
1197169409 X:123414567-123414589 TGTCGGGGGTGGGGGGCTGGGGG - Intronic
1197327978 X:125117546-125117568 TGTCAGGGGGTAGGGGATTAGGG + Intergenic
1197447439 X:126567548-126567570 TGTCAGGGGGTGGGGGCTAGGGG + Intergenic
1197532104 X:127642000-127642022 TTTCAGGGGTTAGGGGTTTGAGG + Intergenic
1197589642 X:128392502-128392524 TGTCAGGGTGTGGGGGCTAGGGG + Intergenic
1197925008 X:131637041-131637063 TGTCAGGGGGTGGGGGCAAGGGG - Intergenic
1197965082 X:132051741-132051763 TGCCAGGGGGTGGGGGCTTGGGG - Intergenic
1198086509 X:133287483-133287505 TGTCATGGGTTGGGGGTTGGTGG - Intergenic
1198621143 X:138511432-138511454 TGCCAGGGGCTGGGGGGTGGGGG + Intergenic
1199384329 X:147206313-147206335 TGTCAGGGGTTGGGGGGCTGGGG + Intergenic
1199712753 X:150482344-150482366 TGACAGGGGCTAGGGGAGGGAGG + Intronic
1199789644 X:151140728-151140750 TGTTGGGGGGTGGGGGCTGGGGG - Intergenic
1199836113 X:151593390-151593412 TGTCAGGGGTGGGGGGTTGGGGG - Intronic
1199930637 X:152515934-152515956 CGTCGGGGGTTGGGGGCTAGGGG + Intergenic
1200181870 X:154155668-154155690 TGCCAGGGATGAGGGACTGGCGG - Intronic
1200187519 X:154192782-154192804 TGCCAGGGATGAGGGACTGGCGG - Intergenic
1200193169 X:154229922-154229944 TGCCAGGGATGAGGGACTGGCGG - Intronic
1200198924 X:154267726-154267748 TGCCAGGGATGAGGGACTGGCGG - Intronic
1200268083 X:154656958-154656980 TGTTGGGGGTGGGGGGCTGGGGG + Intergenic
1200364501 X:155647452-155647474 TGTCAGGGGGTGGGGGCAAGGGG - Intronic
1200370450 X:155719514-155719536 AGCCAGGGGTTAGGGGTTAGGGG - Intergenic
1200403056 X:156030296-156030318 GGTTAGGGGTTAGGGGTTAGGGG + Intergenic
1200403059 X:156030303-156030325 GGTTAGGGGTTAGGGGTTAGGGG + Intergenic
1200403206 X:156030732-156030754 GGTTAGGGGTTAGGGGTTAGGGG + Intergenic
1200403209 X:156030739-156030761 GGTTAGGGGTTAGGGGTTAGGGG + Intergenic
1200403212 X:156030746-156030768 GGTTAGGGGTTAGGGGTTAGGGG + Intergenic
1200403215 X:156030753-156030775 GGTTAGGGGTTAGGGGTTAGGGG + Intergenic
1200405397 Y:2805709-2805731 TGTCATAGGGTGGGGGCTGGGGG - Intergenic
1201153014 Y:11104112-11104134 GGTCAGGGGTTAGGGGTCAGGGG + Intergenic
1201348384 Y:13010234-13010256 TGTCAGGGGGTAGGGGGTGGGGG + Intergenic
1201350818 Y:13039018-13039040 TGTCGGGGATTGGGAGCTGGGGG + Intergenic
1201446914 Y:14067165-14067187 TGTCAAGAGGCAGGGGCTGGAGG + Intergenic
1201512050 Y:14775000-14775022 TGTCAGGGCTTAGGGGTTAGGGG + Intronic
1201562986 Y:15337356-15337378 TGTCAAGGGTTGGGGGCTAGGGG - Intergenic
1201591815 Y:15623644-15623666 TGTCAGTGGTTGGGGGCAAGGGG + Intergenic
1201952104 Y:19576849-19576871 TGTCAGGGGTGGGGGCCTAGGGG + Intergenic