ID: 920645494

View in Genome Browser
Species Human (GRCh38)
Location 1:207800624-207800646
Sequence CTGTGCAAAAAGCCTGATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920645489_920645494 27 Left 920645489 1:207800574-207800596 CCACTGGCTTAAAAGAGTTCTAC No data
Right 920645494 1:207800624-207800646 CTGTGCAAAAAGCCTGATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920645494 Original CRISPR CTGTGCAAAAAGCCTGATCA AGG Intergenic
No off target data available for this crispr