ID: 920647677

View in Genome Browser
Species Human (GRCh38)
Location 1:207815403-207815425
Sequence TGGGACTCTCCCTAATTTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 97}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920647677 Original CRISPR TGGGACTCTCCCTAATTTTG GGG (reversed) Intergenic
905703710 1:40039161-40039183 TGGGCCTCTTCCTAACTTTATGG - Intergenic
907933123 1:59018595-59018617 TGGGACTCTGTCTGATTCTGTGG - Intergenic
912365919 1:109133869-109133891 TGCCATTCTCCCTAATTTTCAGG - Intronic
912596318 1:110880438-110880460 TAGGAATGTCCCTAAGTTTGTGG + Intronic
916698892 1:167270025-167270047 TTGAACTCTCCCTGAGTTTGTGG + Intronic
918516600 1:185370179-185370201 TGGGACTTTCAATAATTTTTCGG - Intergenic
920647677 1:207815403-207815425 TGGGACTCTCCCTAATTTTGGGG - Intergenic
922931938 1:229396834-229396856 AGGGACTCTCCCTAGTTGTCTGG - Intergenic
1062875693 10:941263-941285 TGGGACTCTCCCTGATTAGCTGG - Intergenic
1063463998 10:6231671-6231693 TGGGGCTCTCCCTAGATATGAGG + Intronic
1064147999 10:12840636-12840658 TGGGTCTTTCCCTGCTTTTGGGG - Intergenic
1066422634 10:35276748-35276770 TGGAACTCTCCACAATTTTGGGG + Intronic
1070782648 10:79146588-79146610 TGGGATTCTCCCTGAGTTTGGGG + Intronic
1073981708 10:109161558-109161580 TGTCAATTTCCCTAATTTTGAGG + Intergenic
1079413397 11:20210449-20210471 TGGGGCTCTCCAACATTTTGAGG - Intergenic
1082923687 11:58523327-58523349 TGGGACTGTACCTATTTCTGAGG + Intergenic
1090149708 11:124370141-124370163 TGGGAATGACCCTTATTTTGAGG - Intergenic
1093519981 12:20037706-20037728 TGGGATCCTCCGTAATTTTTAGG - Intergenic
1099853436 12:88134238-88134260 GGAGAGTCTGCCTAATTTTGTGG - Intronic
1102011270 12:109619999-109620021 TGGGCCTCTTCCCCATTTTGGGG - Intergenic
1103395956 12:120607364-120607386 TGGGAGCTTCCCTACTTTTGAGG + Intergenic
1104335768 12:127893206-127893228 TGGGACCCTGACTAAATTTGAGG - Intergenic
1104921999 12:132295390-132295412 TGGGACTCTGCCTGTTTTTCTGG - Intronic
1109126674 13:58527078-58527100 TGGGACTCCAGCTTATTTTGCGG + Intergenic
1112501985 13:99950061-99950083 TGGGCCTGTCCCTAATTTTCTGG + Intergenic
1112814563 13:103256659-103256681 TGAGACTCTCCCAAATTTAAGGG - Intergenic
1114303105 14:21395891-21395913 TGTGCCTCTCCATAATTTTAGGG - Exonic
1116177490 14:41491136-41491158 TGGTACTCTTCCTAAATTTGAGG + Intergenic
1116266112 14:42692606-42692628 TGTCAGTTTCCCTAATTTTGAGG - Intergenic
1120422362 14:84304199-84304221 TGGAACTCTTCAAAATTTTGTGG - Intergenic
1121647112 14:95526039-95526061 TGGGACTCTCCCTCATCCAGAGG + Intergenic
1121701567 14:95958575-95958597 TGAGACTGTCTCAAATTTTGGGG + Intergenic
1125998399 15:44186358-44186380 TGGGCCTCAGTCTAATTTTGAGG - Intronic
1126878491 15:53069886-53069908 TAGGACTTTCTGTAATTTTGTGG + Intergenic
1129602997 15:77011145-77011167 GGTGACTCTCTCTAATGTTGTGG - Intronic
1131563981 15:93468908-93468930 AGGTATTCTCCCCAATTTTGTGG + Intergenic
1135087346 16:19486091-19486113 TGGGAATCTGCCTAATTTGCTGG + Intronic
1136051310 16:27652356-27652378 CGGGATTCTCCTTAAGTTTGAGG + Intronic
1137011110 16:35321332-35321354 GGGTACTTTCTCTAATTTTGGGG - Intergenic
1137585392 16:49661263-49661285 TGGGAGTCTCCATATTTTTCCGG + Intronic
1138068058 16:53962566-53962588 GTGGACTGTCCCTAAATTTGGGG - Intronic
1141249569 16:82342866-82342888 TGTGAGCCTCCCTACTTTTGAGG - Intergenic
1147776378 17:42904590-42904612 AGGGACCTTCCCTAGTTTTGGGG - Intronic
1150641311 17:66951681-66951703 CGCGACTCTCCCTCAGTTTGGGG + Intergenic
1154195564 18:12263677-12263699 TGGGATTCTTCCTTATTTGGTGG - Intronic
1156807240 18:41200062-41200084 TGAGACTGTTCCTAATTTTGAGG + Intergenic
1156913087 18:42434416-42434438 TGGGACTCTCCCACATTTAGAGG + Intergenic
1157069902 18:44393962-44393984 TGGGTTTCGCCCTAATTTTGTGG - Intergenic
1159065405 18:63563564-63563586 TGAGACACTCCCTAGTCTTGGGG + Intronic
1164313374 19:24065689-24065711 TTTGACTCTCCCTTTTTTTGTGG + Intronic
1164792215 19:30996919-30996941 TGGGGCTCTTCACAATTTTGTGG + Intergenic
1164956894 19:32394004-32394026 TGGAACTCCCCTTAATTTTGAGG - Intergenic
1168565301 19:57417354-57417376 AGGGACTATCCCTCCTTTTGTGG + Intronic
927166659 2:20329936-20329958 TTTGACTCTCACTAAATTTGGGG - Intronic
927229353 2:20805176-20805198 TTGAATTCTCACTAATTTTGTGG - Intronic
928522744 2:32106327-32106349 TGGGAGTCTCCCTATTTTCCAGG + Intronic
938610824 2:132945814-132945836 TGGTCCTCTCACTAAGTTTGGGG - Intronic
940255302 2:151722290-151722312 TAACACTCTCCCTTATTTTGAGG - Intronic
943308476 2:186297272-186297294 TGGGATTCTCTCTATTCTTGTGG + Intergenic
1174259454 20:49283218-49283240 AGGGTCTATCCCTAATGTTGCGG + Intergenic
1175301036 20:57942873-57942895 TGGGGTTCTCGTTAATTTTGAGG - Intergenic
1179962244 21:44774755-44774777 TGGGAAACTTCCTGATTTTGTGG - Intronic
951829579 3:26911075-26911097 TGGGACACTCTCTAAGGTTGAGG + Intergenic
962868099 3:139464494-139464516 TCGGCCTCTCCTTGATTTTGGGG - Intronic
965783294 3:172310630-172310652 GGGGACTCTCTCTACTGTTGAGG + Intronic
969518208 4:7660500-7660522 TGGGACTCTGCCTCCTTTGGGGG - Intronic
975385493 4:73754751-73754773 GGGGACACTCCCTTATTTTCTGG - Intergenic
976086545 4:81412665-81412687 TTGGACTCTTCCTAATCTAGAGG + Intergenic
977707960 4:100092562-100092584 TGGGACTGTCTCATATTTTGAGG - Intergenic
977990435 4:103434583-103434605 TAGGATTCTCCCTACTTTTCAGG + Intergenic
980730405 4:136815914-136815936 TGGTTCTCTCACTATTTTTGTGG + Intergenic
990938866 5:61179767-61179789 TGGGATTCTCTCTCATTTAGTGG - Intergenic
994471536 5:100213739-100213761 TGAGACTCTACCTTGTTTTGCGG - Intergenic
996300581 5:121979190-121979212 TGGGATTCTCCCTAGAGTTGTGG - Intronic
998318532 5:141207014-141207036 TGGGACTTTCTCTAGTCTTGGGG - Intergenic
1005306674 6:24520816-24520838 AGGGACTGTACCTTATTTTGGGG - Intronic
1005460343 6:26063222-26063244 TGGTACTCTCCTTAACTTGGAGG + Intergenic
1007629693 6:43265935-43265957 TGGGACTCATCCTCACTTTGGGG + Intronic
1008646124 6:53516739-53516761 AGAGACACTCCCTAATCTTGAGG - Intronic
1011458715 6:87580404-87580426 AAGGACTGTGCCTAATTTTGTGG - Intronic
1016203280 6:141439799-141439821 TGGGAAGGTCACTAATTTTGAGG - Intergenic
1016324370 6:142882727-142882749 TAGGAATCTTCCTAATTTTGAGG + Intronic
1016703848 6:147084076-147084098 TTAGACTTTCCCGAATTTTGTGG - Intergenic
1018041685 6:159929885-159929907 TGGTGCTTTCCCTAATTCTGGGG + Intergenic
1018431193 6:163724189-163724211 TGGGACACTTCCAAATTTGGTGG - Intergenic
1020961632 7:14811735-14811757 TTGGGCTATCCCTTATTTTGAGG + Intronic
1022338410 7:29445191-29445213 TGGGACTCTTACTTATTCTGTGG - Intronic
1023425760 7:40034282-40034304 TGCCTCTCTCTCTAATTTTGGGG + Intronic
1024909928 7:54435761-54435783 TGGCCCTCTTACTAATTTTGAGG - Intergenic
1027254744 7:76424029-76424051 TGGGTCTCTGCCTTATTTTATGG - Intronic
1028423408 7:90659002-90659024 TGGTACTCTCCCTAAATTCTGGG + Intronic
1029353209 7:100030195-100030217 TGGGATTGTCCCTGAGTTTGGGG + Intronic
1032394038 7:131576147-131576169 TGGGACACTCCCTAGGGTTGAGG + Intergenic
1033852104 7:145509863-145509885 AGTTACTCTCCCTATTTTTGTGG + Intergenic
1034218184 7:149423336-149423358 GGGTACTCTACCTAATATTGGGG + Intergenic
1036197492 8:6733135-6733157 TTGAACTCTCCCCACTTTTGTGG - Intronic
1040877789 8:52170966-52170988 TACTCCTCTCCCTAATTTTGTGG + Intronic
1041818750 8:62004536-62004558 TGAGACTCTTACTCATTTTGAGG - Intergenic
1046221933 8:111227905-111227927 TGAGACTATCTCGAATTTTGGGG + Intergenic
1047361961 8:124177632-124177654 TGAGACTCTCCGTGATTCTGTGG + Intergenic
1050051314 9:1604526-1604548 TGGGACTCTCCCTAATGGTCAGG - Intergenic
1051729594 9:20126601-20126623 CGGCACTTTCCCTAACTTTGGGG - Intergenic
1054710890 9:68509762-68509784 AGGGACTGTCCCTAATTTGCTGG + Intronic
1057257722 9:93563981-93564003 GGGGAATCTCCCTCATTTTCAGG + Intronic
1058712751 9:107695181-107695203 TGGGACTCTGCCTAATTAGATGG + Intergenic
1187708583 X:22031260-22031282 TGGGATTCTCTCAAGTTTTGGGG - Intergenic
1191175757 X:57499800-57499822 GGAGACTCTCCTTAATTTTTTGG - Intergenic
1193763942 X:85502704-85502726 TGGGACTTTCCCAAATTCTAGGG - Intergenic