ID: 920659236

View in Genome Browser
Species Human (GRCh38)
Location 1:207901394-207901416
Sequence CACAAGGGTGTACACCCCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 113}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920659231_920659236 6 Left 920659231 1:207901365-207901387 CCAGTCCATCCTGCTAAGGGGAA 0: 1
1: 0
2: 0
3: 9
4: 104
Right 920659236 1:207901394-207901416 CACAAGGGTGTACACCCCCAAGG 0: 1
1: 0
2: 1
3: 8
4: 113
920659230_920659236 7 Left 920659230 1:207901364-207901386 CCCAGTCCATCCTGCTAAGGGGA 0: 1
1: 0
2: 0
3: 3
4: 132
Right 920659236 1:207901394-207901416 CACAAGGGTGTACACCCCCAAGG 0: 1
1: 0
2: 1
3: 8
4: 113
920659226_920659236 15 Left 920659226 1:207901356-207901378 CCGCTTCTCCCAGTCCATCCTGC 0: 1
1: 1
2: 5
3: 56
4: 609
Right 920659236 1:207901394-207901416 CACAAGGGTGTACACCCCCAAGG 0: 1
1: 0
2: 1
3: 8
4: 113
920659232_920659236 1 Left 920659232 1:207901370-207901392 CCATCCTGCTAAGGGGAACTGCA 0: 1
1: 0
2: 1
3: 9
4: 133
Right 920659236 1:207901394-207901416 CACAAGGGTGTACACCCCCAAGG 0: 1
1: 0
2: 1
3: 8
4: 113
920659225_920659236 25 Left 920659225 1:207901346-207901368 CCACGATGGGCCGCTTCTCCCAG 0: 1
1: 0
2: 0
3: 10
4: 101
Right 920659236 1:207901394-207901416 CACAAGGGTGTACACCCCCAAGG 0: 1
1: 0
2: 1
3: 8
4: 113
920659233_920659236 -3 Left 920659233 1:207901374-207901396 CCTGCTAAGGGGAACTGCAGCAC No data
Right 920659236 1:207901394-207901416 CACAAGGGTGTACACCCCCAAGG 0: 1
1: 0
2: 1
3: 8
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920659236 Original CRISPR CACAAGGGTGTACACCCCCA AGG Intronic
901213769 1:7541765-7541787 CACCAGGGTGGTCACCCACAGGG + Intronic
901426526 1:9185126-9185148 CACAAGGGTGGGGACCTCCAAGG - Intergenic
908832545 1:68193600-68193622 CACAGGGGAGTTCACCCCAATGG - Intronic
912748622 1:112267074-112267096 TACAAAGGTGTAAACCCACAAGG + Intergenic
915049211 1:153049779-153049801 CACAAGGGTATACACTGGCATGG - Intergenic
917178507 1:172265873-172265895 AACAAGGCTCTACAACCCCAAGG - Intronic
919786161 1:201259868-201259890 CACCAGGGTGTGGACCCCCAGGG + Intergenic
919920584 1:202164449-202164471 GACAGGTGTGTACACCCTCATGG + Intergenic
920161439 1:204001388-204001410 CACAGGGATTTACACCCTCAGGG - Intergenic
920659236 1:207901394-207901416 CACAAGGGTGTACACCCCCAAGG + Intronic
920703843 1:208237473-208237495 CTCCAGGGTGCACACTCCCAAGG - Intronic
922192679 1:223333153-223333175 CAAAATGGTGCACACACCCACGG + Intronic
922695472 1:227728907-227728929 CACCAGAGTGTCCACCCCCGCGG - Intronic
923730290 1:236543574-236543596 TGCAAGGTTGAACACCCCCATGG + Exonic
1063631435 10:7737277-7737299 CCCGAGGGTGCACACACCCAGGG + Intronic
1064396439 10:14985903-14985925 ATCAAGGGTGTACACACCCGGGG - Intronic
1068703918 10:60051931-60051953 TACAAGGGTATACACCTTCATGG - Intronic
1070811395 10:79299876-79299898 CTGAAGGGTGGACACCCCCAGGG - Intronic
1076113207 10:127876767-127876789 CACCAGGGTATCCGCCCCCATGG - Intergenic
1079038610 11:17042138-17042160 CGCAGGGGTGTACACACCCCCGG - Intergenic
1084294011 11:68198561-68198583 CACAAGGGTGCAGACTCCCATGG + Intronic
1084798554 11:71526050-71526072 CACAAGGGTGGAGTTCCCCAAGG + Intergenic
1090605662 11:128420737-128420759 CACAAGGCTGTACGCACACATGG - Intergenic
1091980278 12:4858923-4858945 CATGAGGGTGTACACCTCAATGG + Intergenic
1095917780 12:47497590-47497612 CTCAGGTGTGTACACCACCAGGG + Intergenic
1097988665 12:65811151-65811173 CAGAAGTGTGGACAACCCCATGG - Intergenic
1102585068 12:113917083-113917105 CCCTAGGGTGTAAACTCCCAAGG + Intronic
1107620561 13:42224751-42224773 CAAAAGAGAGTACATCCCCAAGG - Intronic
1109355726 13:61228886-61228908 CAGGAGGTTGTACACCCCCTGGG + Intergenic
1112196074 13:97227719-97227741 GACAAGCATGTGCACCCCCAGGG - Intronic
1112324987 13:98438149-98438171 CTCAAGAGTGTACAGCCCCGGGG + Intronic
1113392031 13:109907254-109907276 CACAAGGCTGTAAATCCACATGG - Intergenic
1113482444 13:110631474-110631496 CAGAAGGGTGTCCCCACCCATGG - Intronic
1113632154 13:111895592-111895614 TACATGTGTGTACACCCGCATGG + Intergenic
1116518828 14:45827531-45827553 CAGGGGGGTGTACACCCCCTGGG - Intergenic
1119749901 14:77069794-77069816 CACGTGGGTGTGCAGCCCCAGGG + Intergenic
1119903984 14:78285028-78285050 CCCAAGGGCGTACACCTCCTGGG - Intronic
1120583280 14:86280133-86280155 CACAAGGTTGGAGACGCCCAAGG + Intergenic
1123116482 14:105896460-105896482 CGCAGGGCTGTATACCCCCAAGG - Intergenic
1202900422 14_GL000194v1_random:33352-33374 CAGAGGGGTGTAAACCCCCTGGG - Intergenic
1127137928 15:55943906-55943928 CACAGGGGTGGAGACACCCAAGG + Intronic
1131483907 15:92804546-92804568 CATAAGGATGTACAGGCCCAGGG + Intronic
1132540331 16:505460-505482 CAGAAGGGCCTGCACCCCCAAGG - Intronic
1132605246 16:790982-791004 CACCAGGGGCTCCACCCCCACGG - Intronic
1136228968 16:28876102-28876124 CACAGGGGTCTCCACGCCCAGGG - Intergenic
1137505839 16:49052997-49053019 CACAAGGCTGGACACCCTCGGGG - Intergenic
1141626097 16:85261889-85261911 CACGAGGGTTTAGCCCCCCAGGG - Intergenic
1142860199 17:2756253-2756275 CCCCAGAGTGCACACCCCCAGGG - Intergenic
1150624762 17:66834935-66834957 CACAAGGGTGCTCACCCCAGAGG + Intergenic
1152093262 17:78258404-78258426 CAGAAGTGTGCACACCCCCCAGG + Intergenic
1152517244 17:80832761-80832783 CCAAAGTGTGTACATCCCCAGGG + Intronic
1156255826 18:35395413-35395435 CCCAAATGTGCACACCCCCATGG + Intergenic
1156375561 18:36512117-36512139 CACCAGGCTCTACTCCCCCACGG - Intronic
1160622419 18:80180457-80180479 CTCCATGGTGTACACCCCCCAGG + Intronic
1161017033 19:1988172-1988194 CTCAAGCGCTTACACCCCCAGGG + Intronic
1162066430 19:8128216-8128238 CACATGGTTGTACACACTCAGGG - Intronic
1162501187 19:11054862-11054884 CAAAGGGGAGTCCACCCCCATGG - Intronic
1165802501 19:38561670-38561692 CACAAGGATGCACACCCCTTGGG + Intronic
1166244240 19:41514515-41514537 CAAAGGGGTGTACACTCCCTGGG + Intergenic
933488336 2:82950665-82950687 CACAAGTGCCTACACCACCAGGG - Intergenic
934097278 2:88618389-88618411 GACCTGGGTGTACATCCCCAAGG + Intronic
940871408 2:158863555-158863577 ATCAAGGGTGTACACACCCGGGG + Intergenic
942944522 2:181657815-181657837 GAAAAGGGTGAACCCCCCCAGGG - Intronic
943811705 2:192195572-192195594 CACAAGAGCGTGCAACCCCAAGG + Exonic
946489851 2:220137424-220137446 CAGAAGAGTGTAAACCCCAAGGG - Intergenic
1172894217 20:38288088-38288110 CCCAAGGGTGTACACTCCACAGG - Intronic
1174281612 20:49443876-49443898 CACAAGGTTGGACCCCTCCATGG + Intronic
1175170858 20:57080489-57080511 CACTGGAGTGTACACCTCCATGG + Intergenic
1176619796 21:9048130-9048152 CAGAGGGGTGTAAACCCCCTGGG - Intergenic
1178514076 21:33230803-33230825 CAGAAGGGTGCACCCTCCCAGGG + Intronic
1178712780 21:34934201-34934223 CAACAGGGTGTACAGTCCCAAGG - Intronic
1179797639 21:43794639-43794661 CAGAAGGGTGTTGAGCCCCATGG + Intronic
953755287 3:45640869-45640891 CAGGAGGGTGTGCAGCCCCAGGG - Intronic
958712600 3:97736097-97736119 CACAAGGATGTCCTCCACCAGGG - Exonic
961274116 3:125713352-125713374 ATCAAGGGTGTACACACACAGGG + Intergenic
961562534 3:127740605-127740627 CAGTAGGGGGTACACCCCAAGGG + Intronic
963538879 3:146562073-146562095 CACAAGGGTGTAGCTGCCCAAGG - Intergenic
967040607 3:185688972-185688994 CACAAGAATGGCCACCCCCAGGG + Intronic
969581273 4:8067021-8067043 GACAAGAGTGTTCACCCCAAGGG - Intronic
983624491 4:169789352-169789374 CAGGAGGGTGTACACTCCCTGGG + Intergenic
990983920 5:61625182-61625204 CAGAACGCTGTACACCCCGACGG - Intergenic
992154940 5:73945684-73945706 CACAGGGTTGCACACCACCAGGG + Intergenic
993311522 5:86338362-86338384 CACTATGGTGAACACCCTCAGGG + Intergenic
994391555 5:99197870-99197892 CAGAGGGGTGTACACCCCCTGGG + Intergenic
995686247 5:114775696-114775718 CCCAAGGGTATACATCCCAAGGG - Intergenic
995922882 5:117334550-117334572 CACAGGGGTCTCCAACCCCAGGG - Intergenic
997682868 5:135768465-135768487 CAGAAAGGTGTACACTCCCTGGG - Intergenic
1004868621 6:19879752-19879774 CTGTAGGGTATACACCCCCAGGG + Intergenic
1009298630 6:61986824-61986846 CATAAGGGTGGAGTCCCCCATGG - Intronic
1009367046 6:62863945-62863967 CAGAGGGGTGTACACCCCCGTGG + Intergenic
1010011428 6:71051864-71051886 CTCAAGAGTGTACAGCCCCAGGG - Intergenic
1015624942 6:135171162-135171184 CACAAGATTGTACACCACTATGG + Intergenic
1020305889 7:6834519-6834541 ATCAAGGGTGTACACACCCGGGG - Intergenic
1022286757 7:28961029-28961051 CACAAGTGTGTATACTCCTAGGG + Intergenic
1023725729 7:43141265-43141287 CACCAGGGTGCCCACCCCCACGG + Intronic
1029080030 7:97965795-97965817 ATCAAGGGTGTACACACCCGGGG - Intergenic
1032785446 7:135196385-135196407 CACCAGGGTGTACACCGCAGGGG + Intronic
1035055867 7:156035808-156035830 CACACTGATGTACACCTCCATGG + Intergenic
1035130653 7:156650233-156650255 CAAGAGGGTGCACAGCCCCAGGG + Intronic
1035618712 8:1022152-1022174 CACAGGACTGTCCACCCCCAGGG - Intergenic
1037108670 8:15140161-15140183 CACACAGGTGTGCACCACCATGG + Intronic
1038489667 8:27961232-27961254 CATGAGGGTATCCACCCCCATGG - Intronic
1045478692 8:102575554-102575576 CACACGGGCAGACACCCCCAGGG + Intergenic
1045926997 8:107586070-107586092 CGCAAGGGTGTGAACCCCCATGG - Intergenic
1046695618 8:117336041-117336063 CTCAAGGTTGTGCACTCCCAGGG + Intergenic
1050845819 9:10216893-10216915 CACTAGAGTGAACATCCCCATGG - Intronic
1052187727 9:25619760-25619782 CACAGGGGTGTAGCCACCCAAGG - Intergenic
1052440125 9:28485773-28485795 CACAAGGTTTGACACTCCCATGG + Intronic
1053738248 9:41115606-41115628 CAGGAGGATGTACACCCCCTGGG - Intergenic
1054354641 9:64049384-64049406 CAGAGGGGTGTAAACCCCCTGGG - Intergenic
1054690104 9:68315712-68315734 CAGGAGGATGTACACCCCCTGGG + Intergenic
1057217334 9:93236292-93236314 CCCAGTAGTGTACACCCCCAGGG - Intronic
1058520130 9:105808439-105808461 CAAAGGGGTGTACACCAACATGG - Intergenic
1060896608 9:127222577-127222599 CACAAGCGTGTACACCCCCTGGG + Exonic
1061179142 9:129013778-129013800 CCCAAGGGTGAACACCCTCCTGG - Intronic
1061860095 9:133463642-133463664 CACAAGGATGCCCACTCCCACGG - Intronic
1203742979 Un_GL000218v1:18508-18530 CAGAGGGGTGTAAACCCCCTGGG - Intergenic
1185847092 X:3447815-3447837 CACACAGGTGTACACACTCAGGG - Intergenic
1187159548 X:16751619-16751641 CACAAACATGTACACACCCAAGG - Intronic
1189596292 X:42569644-42569666 CTCTAGGGTGTACACCCAGAAGG + Intergenic
1192337873 X:70237083-70237105 CTCATGGGGGTTCACCCCCATGG + Exonic
1197332453 X:125170694-125170716 CTCAAGGGTGTATACCCTCTAGG + Intergenic
1201156505 Y:11135977-11135999 CAGAGGGGTGTAAACCCCCTGGG - Intergenic