ID: 920665228

View in Genome Browser
Species Human (GRCh38)
Location 1:207958813-207958835
Sequence CAGCCTTAATCGCAGTAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920665222_920665228 11 Left 920665222 1:207958779-207958801 CCCTGCATAACGCAAGCTCTTTA No data
Right 920665228 1:207958813-207958835 CAGCCTTAATCGCAGTAAGGGGG No data
920665223_920665228 10 Left 920665223 1:207958780-207958802 CCTGCATAACGCAAGCTCTTTAG No data
Right 920665228 1:207958813-207958835 CAGCCTTAATCGCAGTAAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920665228 Original CRISPR CAGCCTTAATCGCAGTAAGG GGG Intergenic
No off target data available for this crispr