ID: 920665296

View in Genome Browser
Species Human (GRCh38)
Location 1:207959108-207959130
Sequence CAAGAGATGCTGGCTTCCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920665296_920665298 -9 Left 920665296 1:207959108-207959130 CCGGGGGAAGCCAGCATCTCTTG No data
Right 920665298 1:207959122-207959144 CATCTCTTGCCCTCCAGTGCCGG No data
920665296_920665303 9 Left 920665296 1:207959108-207959130 CCGGGGGAAGCCAGCATCTCTTG No data
Right 920665303 1:207959140-207959162 GCCGGCGCCCGGCAGAGCCCCGG No data
920665296_920665299 -2 Left 920665296 1:207959108-207959130 CCGGGGGAAGCCAGCATCTCTTG No data
Right 920665299 1:207959129-207959151 TGCCCTCCAGTGCCGGCGCCCGG No data
920665296_920665305 10 Left 920665296 1:207959108-207959130 CCGGGGGAAGCCAGCATCTCTTG No data
Right 920665305 1:207959141-207959163 CCGGCGCCCGGCAGAGCCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920665296 Original CRISPR CAAGAGATGCTGGCTTCCCC CGG (reversed) Intergenic