ID: 920667505

View in Genome Browser
Species Human (GRCh38)
Location 1:207974091-207974113
Sequence CTGTCCAAAGAGCAGGTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920667499_920667505 4 Left 920667499 1:207974064-207974086 CCACAACCAGCATTAGCCTCCCA No data
Right 920667505 1:207974091-207974113 CTGTCCAAAGAGCAGGTTGCTGG No data
920667500_920667505 -2 Left 920667500 1:207974070-207974092 CCAGCATTAGCCTCCCACATGCT No data
Right 920667505 1:207974091-207974113 CTGTCCAAAGAGCAGGTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920667505 Original CRISPR CTGTCCAAAGAGCAGGTTGC TGG Intergenic
No off target data available for this crispr