ID: 920671888

View in Genome Browser
Species Human (GRCh38)
Location 1:208010001-208010023
Sequence GTACAGATTTGCAGGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920671883_920671888 -2 Left 920671883 1:208009980-208010002 CCTGAGAGGAGTCTGCAGGGAGT No data
Right 920671888 1:208010001-208010023 GTACAGATTTGCAGGGAGGAGGG No data
920671876_920671888 9 Left 920671876 1:208009969-208009991 CCCCCACCAAGCCTGAGAGGAGT No data
Right 920671888 1:208010001-208010023 GTACAGATTTGCAGGGAGGAGGG No data
920671878_920671888 7 Left 920671878 1:208009971-208009993 CCCACCAAGCCTGAGAGGAGTCT No data
Right 920671888 1:208010001-208010023 GTACAGATTTGCAGGGAGGAGGG No data
920671877_920671888 8 Left 920671877 1:208009970-208009992 CCCCACCAAGCCTGAGAGGAGTC No data
Right 920671888 1:208010001-208010023 GTACAGATTTGCAGGGAGGAGGG No data
920671880_920671888 3 Left 920671880 1:208009975-208009997 CCAAGCCTGAGAGGAGTCTGCAG No data
Right 920671888 1:208010001-208010023 GTACAGATTTGCAGGGAGGAGGG No data
920671872_920671888 14 Left 920671872 1:208009964-208009986 CCCCTCCCCCACCAAGCCTGAGA No data
Right 920671888 1:208010001-208010023 GTACAGATTTGCAGGGAGGAGGG No data
920671874_920671888 12 Left 920671874 1:208009966-208009988 CCTCCCCCACCAAGCCTGAGAGG No data
Right 920671888 1:208010001-208010023 GTACAGATTTGCAGGGAGGAGGG No data
920671873_920671888 13 Left 920671873 1:208009965-208009987 CCCTCCCCCACCAAGCCTGAGAG No data
Right 920671888 1:208010001-208010023 GTACAGATTTGCAGGGAGGAGGG No data
920671871_920671888 15 Left 920671871 1:208009963-208009985 CCCCCTCCCCCACCAAGCCTGAG No data
Right 920671888 1:208010001-208010023 GTACAGATTTGCAGGGAGGAGGG No data
920671879_920671888 6 Left 920671879 1:208009972-208009994 CCACCAAGCCTGAGAGGAGTCTG No data
Right 920671888 1:208010001-208010023 GTACAGATTTGCAGGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920671888 Original CRISPR GTACAGATTTGCAGGGAGGA GGG Intergenic
No off target data available for this crispr