ID: 920674607

View in Genome Browser
Species Human (GRCh38)
Location 1:208030403-208030425
Sequence GAGCATCCCCGGCCCAGCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 181}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920674607_920674612 -5 Left 920674607 1:208030403-208030425 CCAGCGCTGGGCCGGGGATGCTC 0: 1
1: 0
2: 1
3: 20
4: 181
Right 920674612 1:208030421-208030443 TGCTCCAAAGCAAAGGGGACAGG 0: 1
1: 0
2: 0
3: 18
4: 191
920674607_920674617 26 Left 920674607 1:208030403-208030425 CCAGCGCTGGGCCGGGGATGCTC 0: 1
1: 0
2: 1
3: 20
4: 181
Right 920674617 1:208030452-208030474 GTCCAGGGAATGCAGATGGAAGG 0: 1
1: 0
2: 2
3: 29
4: 342
920674607_920674616 22 Left 920674607 1:208030403-208030425 CCAGCGCTGGGCCGGGGATGCTC 0: 1
1: 0
2: 1
3: 20
4: 181
Right 920674616 1:208030448-208030470 TGCTGTCCAGGGAATGCAGATGG 0: 1
1: 0
2: 2
3: 22
4: 265
920674607_920674614 10 Left 920674607 1:208030403-208030425 CCAGCGCTGGGCCGGGGATGCTC 0: 1
1: 0
2: 1
3: 20
4: 181
Right 920674614 1:208030436-208030458 GGGACAGGCATGTGCTGTCCAGG 0: 1
1: 0
2: 0
3: 20
4: 237
920674607_920674611 -10 Left 920674607 1:208030403-208030425 CCAGCGCTGGGCCGGGGATGCTC 0: 1
1: 0
2: 1
3: 20
4: 181
Right 920674611 1:208030416-208030438 GGGGATGCTCCAAAGCAAAGGGG 0: 1
1: 0
2: 0
3: 25
4: 160
920674607_920674615 11 Left 920674607 1:208030403-208030425 CCAGCGCTGGGCCGGGGATGCTC 0: 1
1: 0
2: 1
3: 20
4: 181
Right 920674615 1:208030437-208030459 GGACAGGCATGTGCTGTCCAGGG 0: 1
1: 0
2: 1
3: 19
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920674607 Original CRISPR GAGCATCCCCGGCCCAGCGC TGG (reversed) Intronic