ID: 920674607

View in Genome Browser
Species Human (GRCh38)
Location 1:208030403-208030425
Sequence GAGCATCCCCGGCCCAGCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 181}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920674607_920674617 26 Left 920674607 1:208030403-208030425 CCAGCGCTGGGCCGGGGATGCTC 0: 1
1: 0
2: 1
3: 20
4: 181
Right 920674617 1:208030452-208030474 GTCCAGGGAATGCAGATGGAAGG 0: 1
1: 0
2: 2
3: 29
4: 342
920674607_920674612 -5 Left 920674607 1:208030403-208030425 CCAGCGCTGGGCCGGGGATGCTC 0: 1
1: 0
2: 1
3: 20
4: 181
Right 920674612 1:208030421-208030443 TGCTCCAAAGCAAAGGGGACAGG 0: 1
1: 0
2: 0
3: 18
4: 191
920674607_920674614 10 Left 920674607 1:208030403-208030425 CCAGCGCTGGGCCGGGGATGCTC 0: 1
1: 0
2: 1
3: 20
4: 181
Right 920674614 1:208030436-208030458 GGGACAGGCATGTGCTGTCCAGG 0: 1
1: 0
2: 0
3: 20
4: 237
920674607_920674615 11 Left 920674607 1:208030403-208030425 CCAGCGCTGGGCCGGGGATGCTC 0: 1
1: 0
2: 1
3: 20
4: 181
Right 920674615 1:208030437-208030459 GGACAGGCATGTGCTGTCCAGGG 0: 1
1: 0
2: 1
3: 19
4: 215
920674607_920674616 22 Left 920674607 1:208030403-208030425 CCAGCGCTGGGCCGGGGATGCTC 0: 1
1: 0
2: 1
3: 20
4: 181
Right 920674616 1:208030448-208030470 TGCTGTCCAGGGAATGCAGATGG 0: 1
1: 0
2: 2
3: 22
4: 265
920674607_920674611 -10 Left 920674607 1:208030403-208030425 CCAGCGCTGGGCCGGGGATGCTC 0: 1
1: 0
2: 1
3: 20
4: 181
Right 920674611 1:208030416-208030438 GGGGATGCTCCAAAGCAAAGGGG 0: 1
1: 0
2: 0
3: 25
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920674607 Original CRISPR GAGCATCCCCGGCCCAGCGC TGG (reversed) Intronic
900111077 1:1005897-1005919 GGGCATGCGTGGCCCAGCGCGGG + Intergenic
900181567 1:1313293-1313315 GAACAGCCCCAGCCCAGCCCTGG - Intronic
900618446 1:3576131-3576153 AGGCTTCCCCGGCCCAGTGCAGG - Intronic
901528043 1:9836272-9836294 CAGCACCTCCTGCCCAGCGCTGG - Intergenic
903172595 1:21563262-21563284 CAGCGTCCTTGGCCCAGCGCAGG - Exonic
903260360 1:22128564-22128586 GAGCATCCCAGCCCCAGCCAGGG + Intronic
903724413 1:25430408-25430430 GAGCATCCCAGGAACAGCGCCGG - Intergenic
904316542 1:29669798-29669820 GGGCAGCCCCTGCCCAGCACTGG - Intergenic
904383245 1:30125403-30125425 GGGCAGCCCCTGCCCAGCACTGG + Intergenic
910384540 1:86666464-86666486 GAGCTCCCCCAGCCCCGCGCAGG - Intergenic
914256244 1:145962591-145962613 GAGCGCCCCGGGCACAGCGCCGG + Exonic
915529468 1:156494927-156494949 GAGCCTCCCAGGCCCAGACCTGG - Intronic
919738997 1:200971427-200971449 GGGCATCCCCGGCCCGGGGGTGG + Intronic
919739198 1:200972315-200972337 GAGACTCCCCGGCCCAGTGGGGG + Intronic
920674607 1:208030403-208030425 GAGCATCCCCGGCCCAGCGCTGG - Intronic
922738444 1:228002415-228002437 GTGCATCTCAGGCCCAGCCCTGG + Intergenic
922774083 1:228207080-228207102 CAGCATCCCCTCCCCAGGGCTGG + Intronic
923000489 1:230002862-230002884 TTGCATCTCCGGCCCAGGGCAGG + Intergenic
1065821447 10:29529358-29529380 GAGCATCACCGGCCAGGAGCGGG + Intronic
1066022777 10:31319587-31319609 CCGCATCCCCGGCGCAGGGCGGG + Intronic
1067570640 10:47368693-47368715 TTGCAGCCCCGGCCCAGCTCAGG + Exonic
1067792702 10:49299835-49299857 GACCCTGCCTGGCCCAGCGCTGG - Intronic
1069876984 10:71569038-71569060 GAGCTTCCCCGCTCCAGCCCTGG + Intronic
1070154474 10:73824995-73825017 GAACCTCCCAGGCCCAGCCCAGG - Intronic
1070790285 10:79185118-79185140 GAGCATCCCAGGCCAAGCCTTGG + Intronic
1070807271 10:79277893-79277915 GAGCATCCCCAGCTCAGCAAGGG - Intronic
1074490351 10:113934317-113934339 CAGCATCCCCAACCCAGGGCTGG - Intergenic
1074568476 10:114602843-114602865 GAACATCCCAGTCCCAGGGCTGG - Intronic
1076647063 10:131960935-131960957 CAGCACCCCTGGCCCAGCCCAGG - Intergenic
1077327344 11:1969438-1969460 GAGCCCCCCCTGCCCAGGGCCGG - Intronic
1081650121 11:44818275-44818297 TAGCATCCCCTGCCCAGGGAGGG - Intronic
1081811306 11:45915610-45915632 GAGCATCCCTGGCCTCCCGCCGG - Intronic
1081812520 11:45922037-45922059 GGGGATCCCCGGCCCTGCCCAGG + Intronic
1083684523 11:64368510-64368532 AAGCTGCCCTGGCCCAGCGCAGG - Exonic
1083741949 11:64715941-64715963 AAGCATCCCCAGCCCAGGGCAGG + Intronic
1084019477 11:66409224-66409246 GGGACTCCCCGGCCCGGCGCGGG - Intergenic
1084219730 11:67670652-67670674 GAGCAGCCCCTGCCCGGCTCAGG + Intronic
1090029764 11:123196257-123196279 GAGCAGCCCCGCCCCAGGGTCGG + Intergenic
1202810326 11_KI270721v1_random:24618-24640 GAGCCCCCCCTGCCCAGGGCCGG - Intergenic
1091879195 12:3963010-3963032 GGGCAACCCTGGCCCAGCTCAGG - Intergenic
1094819244 12:34211694-34211716 GACACTCCCAGGCCCAGCGCAGG + Intergenic
1095098004 12:38158233-38158255 GATCCCCCCGGGCCCAGCGCAGG - Intergenic
1095098506 12:38160222-38160244 GACCATCCCTGGCCCGGCGCAGG - Intergenic
1102119413 12:110429153-110429175 GAGCAGCCCCAGCCCACCTCAGG + Intergenic
1102386888 12:112517405-112517427 TAGCGTCCCCGGCCCAGAGCAGG + Intergenic
1102997527 12:117361463-117361485 GGGCTTCCCCGGCGCAGTGCTGG + Intronic
1103458791 12:121087695-121087717 GAGCATCCCCGACTCAGGCCTGG + Intergenic
1103724309 12:122990153-122990175 GAGAATCCCTGGCCCAGCACGGG + Intronic
1103764613 12:123271485-123271507 GGGCATCCCCGGGCCGGGGCCGG + Intronic
1104829520 12:131740365-131740387 GAGCATCCACCTCCCAGGGCAGG - Intronic
1105281029 13:18962739-18962761 GGCCTTCCCCGGCCCAGCCCAGG + Intergenic
1105290231 13:19048751-19048773 GGCCTTCCCCGGCCCAGCCCAGG + Intergenic
1105723082 13:23135321-23135343 GAGCAGCCCCAGCCCACCTCAGG - Intergenic
1106121005 13:26860079-26860101 GACCAACCCCAGCCCAGGGCTGG - Intergenic
1108322541 13:49302375-49302397 GGGCTTCCCAGGCCCAGCACAGG - Intergenic
1108710435 13:53027814-53027836 CAGCATCCCCGGCCCAGAGCTGG + Intergenic
1110144797 13:72177685-72177707 GGGCATCCCCAGCCCAGGGTGGG - Intergenic
1112416188 13:99205327-99205349 GAGGATCCGGGGCCCAGGGCAGG + Intronic
1113367235 13:109687730-109687752 GAGCAAACCCTGCCCAGAGCCGG - Intergenic
1113388850 13:109876089-109876111 GAGCATCCCATGCACAGAGCAGG - Intergenic
1115768548 14:36647555-36647577 GAGCAGCCACGGCCCAGGGAAGG - Intergenic
1119203868 14:72779475-72779497 GTGCATCCCCAGCCCAGCAGAGG - Intronic
1121168829 14:91836332-91836354 GCGCGGCGCCGGCCCAGCGCGGG - Intronic
1122552462 14:102557361-102557383 CAGCATCCCCTGCCCAGCCGTGG + Intergenic
1123020491 14:105395714-105395736 GAGCCTCCCAGGCCCTGCACGGG - Exonic
1124453844 15:29822493-29822515 GAGCATGCCCGGCCCGGCGGGGG + Exonic
1128325197 15:66719601-66719623 AAGAGTCCCAGGCCCAGCGCTGG - Intronic
1128803174 15:70510078-70510100 GTGCCTCCCCAGCCCAGCTCTGG + Intergenic
1130305326 15:82709426-82709448 CTGGAGCCCCGGCCCAGCGCGGG - Intronic
1132265822 15:100469894-100469916 CAGCATTCCCAGCCCAGCTCAGG - Intronic
1132583067 16:694151-694173 CCGCGCCCCCGGCCCAGCGCGGG - Exonic
1132637430 16:958970-958992 CAGCATCCCCGGCACAGCGAGGG - Intronic
1132764208 16:1526236-1526258 GGGCATCCCCGTCCCACGGCTGG + Intronic
1132934924 16:2475304-2475326 GGGGATCCCCGGCCACGCGCGGG + Intronic
1133188686 16:4117261-4117283 TCGCCTCCCAGGCCCAGCGCCGG + Intergenic
1133464859 16:6019505-6019527 GAGCGCCCCCGCCCCACCGCGGG - Intronic
1134241185 16:12508241-12508263 ACGCATCCCCGGCCCTGCTCCGG + Intronic
1139291739 16:65864642-65864664 GAGCATGCCCAGCCCAGCTTCGG + Intergenic
1140723196 16:77789053-77789075 GAGCCTCCCCGGGCCAAAGCTGG + Intronic
1141622270 16:85242608-85242630 GAGCAGCCCCTGCCCAAAGCAGG + Intergenic
1141626814 16:85265831-85265853 GAGCAGCCCAGGGCCAGGGCAGG + Intergenic
1142376626 16:89710038-89710060 GACCCTCCTCGGCCCAGGGCAGG + Intronic
1142412336 16:89923138-89923160 GACCGCGCCCGGCCCAGCGCTGG + Intronic
1143633549 17:8151903-8151925 GAACATCCCGTTCCCAGCGCTGG - Intronic
1147677596 17:42218781-42218803 GCCCATCCCCGGCCCAGTGGAGG - Exonic
1147688443 17:42300790-42300812 GCCCATCCCCGGCCCAGTGGAGG + Exonic
1148779968 17:50115868-50115890 GAGCATCCACGGGCAAGAGCCGG - Exonic
1148863666 17:50617767-50617789 CAGCAGCCCCAGCCCAGCCCTGG + Intronic
1152326911 17:79646964-79646986 CAGCATCCCCAGCCCAGCAGTGG + Intergenic
1203162599 17_GL000205v2_random:64513-64535 GAGTATCCAAGGCCCAGTGCAGG + Intergenic
1153322210 18:3784614-3784636 GAGCATCGCGGGCGCAGAGCCGG - Intronic
1154009224 18:10561041-10561063 GAGCATCCCTGGCCCTACTCAGG + Intergenic
1157619275 18:49006753-49006775 AAGCATTCCCTGCCCAGCACTGG - Intergenic
1158637958 18:59178015-59178037 GAGCAACCTGGGCCCAGCACTGG + Intergenic
1159241803 18:65751164-65751186 GCGCCTCCCCAGCCCCGCGCAGG - Intronic
1161615631 19:5268680-5268702 CAGCATCCCAGGCGCAGCGCAGG + Intronic
1161995240 19:7707658-7707680 GAGCAGCCCAGGCCCAGCCTGGG + Intergenic
1162097716 19:8320977-8320999 GCGCATCCCCGGACCATCCCTGG - Intronic
1163020268 19:14477838-14477860 GCCCATCCCTGGCCCAGAGCAGG - Exonic
1163086019 19:14979976-14979998 CAGCATCCCTGGCGGAGCGCGGG + Intronic
1163109791 19:15152707-15152729 GAGCCACCCCGGCCCATCCCTGG - Intergenic
1165242892 19:34481822-34481844 GAACGACCCCGGCCCGGCGCCGG + Exonic
1165918646 19:39277772-39277794 GAGCTTCCCCAGCCCTGCCCTGG + Intergenic
1168658918 19:58150837-58150859 GAGCTTCCCCCGCCCAACGCTGG + Intronic
1168692882 19:58387346-58387368 TAGGATCCCCGGCCCCGCGGCGG - Exonic
925457088 2:4024845-4024867 GAGCATCCCCTGCCCGGCCCTGG - Intergenic
926095694 2:10079828-10079850 GCGCGTCCCCGCCCCAGCCCTGG - Intronic
927510682 2:23642257-23642279 GACCATCCCCGGCCCTGCACTGG - Intronic
928170132 2:28998191-28998213 GAGCACCCGGGGCCCAGCACTGG - Exonic
929762488 2:44817476-44817498 GGGCATCCCAGGCCAAGCGCAGG - Intergenic
932757237 2:74417331-74417353 GAGCAGCCCCAGCCCACCTCAGG + Intronic
934950693 2:98573474-98573496 CAGCATAACCTGCCCAGCGCTGG + Intronic
935317672 2:101852778-101852800 GAGCATCCCCTGCCCCCAGCAGG + Intronic
937294207 2:120799915-120799937 GAGCATCCCCGCCCCTGAGGGGG - Intronic
939842085 2:147201495-147201517 AAGCATCCCCCGCCCACCCCCGG - Intergenic
945225713 2:207529845-207529867 GAGCGGCCCCGCCCCCGCGCTGG - Intronic
947750138 2:232527752-232527774 GAGAATGCCCCGCCCAGAGCCGG + Intronic
948132110 2:235608496-235608518 CAGCCTCCCTGGCCCAGCGTTGG + Intronic
1169073737 20:2749521-2749543 CAGGACCCCCGGCCCAGCCCCGG + Intronic
1169524133 20:6404569-6404591 GAGCATCCAAGGCTCAGCCCAGG + Intergenic
1172781327 20:37438505-37438527 CAGCCTCCCCAGCCCAGAGCAGG + Intergenic
1173329405 20:42062021-42062043 GAGGTGCCCTGGCCCAGCGCAGG + Intergenic
1174659435 20:52198349-52198371 GAGCTTCTCCGGCCCAGCCAAGG - Intronic
1174898682 20:54476093-54476115 GAGAGTCCCCGGCCGCGCGCCGG + Intronic
1175190125 20:57206184-57206206 TGGCCTCCCCGGCCCAGCCCAGG + Intronic
1175859577 20:62143171-62143193 CCGCGTCCCCGGCCCCGCGCAGG + Intronic
1175894327 20:62329385-62329407 GAGCAGCCAGGGCCCAGGGCTGG - Intronic
1176009037 20:62881934-62881956 GAGCCTCCCGGGTCCACCGCAGG - Exonic
1176383691 21:6126623-6126645 GAGCATCCCCCACCCACCCCGGG + Intergenic
1179524644 21:41967780-41967802 GGGCAGCCCCAGCCCAGCACTGG - Intergenic
1179739779 21:43411615-43411637 GAGCATCCCCCACCCACCCCGGG - Intergenic
1181269707 22:21652107-21652129 GCGAATCCCCGCGCCAGCGCCGG + Intergenic
1183117968 22:35706450-35706472 GAGCATCTCCAGCCCAGGGAAGG + Intergenic
1183591367 22:38781111-38781133 TAGCCTCCCTGGCCCAGCCCTGG + Intronic
1184554553 22:45226027-45226049 GGGCGTCCGGGGCCCAGCGCAGG + Intronic
1185317864 22:50186460-50186482 GACCCTCCCCGCCCCAGCCCTGG - Intronic
1185340531 22:50288931-50288953 GAGCCTCCCCGCCCCAGCCTGGG + Intronic
950128347 3:10524957-10524979 GAGCCTCCCATGCCCAGCACAGG - Intronic
950444569 3:13028918-13028940 GAGGATCCCTTGGCCAGCGCAGG - Intronic
961537099 3:127576928-127576950 CAGCATCCCCAGCCCACCCCAGG + Intronic
961559714 3:127720246-127720268 CAGCAGCCCCTGCCCAGCACTGG + Intronic
962532802 3:136298900-136298922 GAGCATCCCTGGCCCAGACCAGG - Intronic
967171812 3:186827644-186827666 GAGCAGCCCCGAGCCAGCTCCGG - Intergenic
968199559 3:196740264-196740286 GCGGCTCCCCGGCCCCGCGCGGG - Intronic
968576793 4:1370378-1370400 GGGCAGCCCCTGCTCAGCGCTGG - Intronic
968983728 4:3864525-3864547 GGGCATCCGCGGCCCTGGGCTGG + Intergenic
982129732 4:152217578-152217600 GAGCATCCCAGGGCCAAGGCTGG - Intergenic
984349215 4:178569664-178569686 GAGCAACCCCAGACCAGTGCAGG - Intergenic
985636630 5:1038879-1038901 GAGCATCCGCGGCTCCCCGCAGG + Exonic
985657280 5:1138921-1138943 GAGTATCCCCGGCTCACCTCAGG - Intergenic
985679008 5:1246329-1246351 GAGCCAGCCCGGCCAAGCGCAGG - Intergenic
994935312 5:106246484-106246506 GAGCCTCCCCGCCCCACCGTGGG + Intergenic
999300202 5:150486154-150486176 GAGCTGCCCCGGCGCAGCGCCGG + Intronic
999384999 5:151147826-151147848 GAGGATCCCAGGCCCAGAGAAGG + Intronic
1001663380 5:173413057-173413079 GAGCATCCCCCCCACAGCCCGGG - Intergenic
1002846293 6:948136-948158 GAGCATGGCAGGCCCAGTGCTGG + Intergenic
1006276299 6:33007682-33007704 GAGCATCCCCTGCCCACAGATGG - Intronic
1006443916 6:34068466-34068488 GAGCATCCCAGGCACAGTGGGGG - Intronic
1006474507 6:34245670-34245692 GAGCAGCCCCAGCCCACCTCAGG - Exonic
1008886220 6:56433346-56433368 GAGCTTCCTGGGCCCGGCGCGGG + Intergenic
1013582731 6:111552090-111552112 GAGCCTCCCCGGCACCGAGCAGG - Intergenic
1015860904 6:137678894-137678916 TAGCATCCCTGTTCCAGCGCAGG - Intergenic
1017628131 6:156369074-156369096 GAGCATCCCCTCCCCACCTCTGG + Intergenic
1019357831 7:590196-590218 GAGCACCACCGGCCCAGCAAAGG + Intronic
1019538884 7:1542589-1542611 GTGCTTCCCCGGCCCAGCTCTGG - Exonic
1020210308 7:6153949-6153971 GAGGAGCCTCCGCCCAGCGCCGG + Exonic
1022427692 7:30284645-30284667 GAGGTTCCCCGGCCCCGCGCCGG - Exonic
1023836122 7:44068191-44068213 CTGCATCCAGGGCCCAGCGCAGG - Intronic
1024281077 7:47720485-47720507 CAGCTTCCCCAGCCCTGCGCTGG - Intronic
1024308867 7:47950823-47950845 GAGGCTGCCCAGCCCAGCGCTGG - Intronic
1024634678 7:51277111-51277133 GAGCATCCCTGGCCTGGCTCTGG - Intronic
1025099701 7:56124259-56124281 GAGCATCCTTAGCCCAGAGCAGG + Intergenic
1027269707 7:76512827-76512849 CAGCATCCCCGGCCCAGGTCTGG + Intronic
1027320419 7:77006722-77006744 CAGCATCCCCGGCCCAGGTCTGG + Intergenic
1027674752 7:81143550-81143572 CAGCATCCCAGGCCCACAGCAGG - Intergenic
1028020797 7:85768604-85768626 GAGCATGCCTGGCCCAGCCATGG + Intergenic
1029151614 7:98484355-98484377 GAGCAACAGTGGCCCAGCGCAGG + Intergenic
1030459026 7:109807902-109807924 GAGCACCCTGGGCCCAGCCCAGG - Intergenic
1035331969 7:158102308-158102330 AAGCATCCTCGGGCCAGCTCGGG - Intronic
1035734258 8:1876367-1876389 CAGCCTCCCCGGCCCTGCCCGGG + Intronic
1036638842 8:10569609-10569631 AATCATCCCCCGCCCAGCCCTGG + Intergenic
1039589584 8:38735400-38735422 CAGCCTCCCAGGCACAGCGCGGG - Intronic
1042253050 8:66775365-66775387 GAACAGCCCCGGCACTGCGCGGG + Intronic
1043527499 8:81112223-81112245 GAGCAAGCCAGGCCCCGCGCCGG - Intergenic
1045211669 8:100106052-100106074 TAGCAACCCCGGCGCGGCGCCGG - Exonic
1046690872 8:117282916-117282938 GGGCATACCCGGCCCAGCCATGG + Intergenic
1047017839 8:120742513-120742535 GAGCATCCCTGTCTCAGCTCAGG + Intronic
1049615139 8:143572672-143572694 GAGCCTCCCGGGCCCGGCTCCGG + Exonic
1051233808 9:14978336-14978358 GAGCTGCCCCGGTCCAGAGCAGG + Intergenic
1055985940 9:82056605-82056627 GAGCAGCACCGTCCCATCGCAGG - Intergenic
1056799194 9:89679766-89679788 GAGCAGCCCTGGCCCAGGCCTGG + Intergenic
1057221150 9:93258650-93258672 GATCACCCCTGGTCCAGCGCAGG - Intronic
1060831982 9:126722789-126722811 GAGCCTCCCCGGCCGAGGGGTGG - Intergenic
1061901132 9:133672644-133672666 GGTCAGCCCCGGCCCAGCACCGG + Intronic
1062287756 9:135780688-135780710 GAGCCTGCCCTGCCCAGCGTCGG + Intronic
1188156617 X:26749145-26749167 GAGCAGCCCCAGCCCACCTCAGG - Intergenic
1189245200 X:39557956-39557978 TACCATCCCCAGCCCAGCCCTGG - Intergenic
1190308658 X:49101468-49101490 GAGCATGCCGGGCCCCGCGCGGG + Intergenic
1190731706 X:53230893-53230915 GAGCATGGACAGCCCAGCGCTGG + Intergenic
1191253735 X:58271003-58271025 GAACACCCCGGGCCCAGCACAGG + Intergenic
1192584672 X:72309545-72309567 GAACATGCCAGGCCCAGCGCTGG - Intergenic
1199967272 X:152830870-152830892 GCAAAGCCCCGGCCCAGCGCGGG + Intergenic
1200212694 X:154353869-154353891 GGGCATCCCGGGCACAGAGCAGG + Intronic