ID: 920674611

View in Genome Browser
Species Human (GRCh38)
Location 1:208030416-208030438
Sequence GGGGATGCTCCAAAGCAAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 160}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920674598_920674611 6 Left 920674598 1:208030387-208030409 CCTGAAGTGCCCTCTCCCAGCGC No data
Right 920674611 1:208030416-208030438 GGGGATGCTCCAAAGCAAAGGGG 0: 1
1: 0
2: 0
3: 25
4: 160
920674597_920674611 7 Left 920674597 1:208030386-208030408 CCCTGAAGTGCCCTCTCCCAGCG 0: 1
1: 0
2: 1
3: 13
4: 169
Right 920674611 1:208030416-208030438 GGGGATGCTCCAAAGCAAAGGGG 0: 1
1: 0
2: 0
3: 25
4: 160
920674606_920674611 -9 Left 920674606 1:208030402-208030424 CCCAGCGCTGGGCCGGGGATGCT 0: 1
1: 1
2: 1
3: 20
4: 161
Right 920674611 1:208030416-208030438 GGGGATGCTCCAAAGCAAAGGGG 0: 1
1: 0
2: 0
3: 25
4: 160
920674594_920674611 29 Left 920674594 1:208030364-208030386 CCCTGGACTTTCTCTTGATTTCC 0: 1
1: 0
2: 2
3: 30
4: 318
Right 920674611 1:208030416-208030438 GGGGATGCTCCAAAGCAAAGGGG 0: 1
1: 0
2: 0
3: 25
4: 160
920674607_920674611 -10 Left 920674607 1:208030403-208030425 CCAGCGCTGGGCCGGGGATGCTC 0: 1
1: 0
2: 1
3: 20
4: 181
Right 920674611 1:208030416-208030438 GGGGATGCTCCAAAGCAAAGGGG 0: 1
1: 0
2: 0
3: 25
4: 160
920674604_920674611 -4 Left 920674604 1:208030397-208030419 CCTCTCCCAGCGCTGGGCCGGGG 0: 1
1: 1
2: 5
3: 48
4: 431
Right 920674611 1:208030416-208030438 GGGGATGCTCCAAAGCAAAGGGG 0: 1
1: 0
2: 0
3: 25
4: 160
920674596_920674611 8 Left 920674596 1:208030385-208030407 CCCCTGAAGTGCCCTCTCCCAGC 0: 1
1: 0
2: 3
3: 30
4: 271
Right 920674611 1:208030416-208030438 GGGGATGCTCCAAAGCAAAGGGG 0: 1
1: 0
2: 0
3: 25
4: 160
920674602_920674611 -3 Left 920674602 1:208030396-208030418 CCCTCTCCCAGCGCTGGGCCGGG 0: 1
1: 1
2: 1
3: 26
4: 320
Right 920674611 1:208030416-208030438 GGGGATGCTCCAAAGCAAAGGGG 0: 1
1: 0
2: 0
3: 25
4: 160
920674595_920674611 28 Left 920674595 1:208030365-208030387 CCTGGACTTTCTCTTGATTTCCC 0: 1
1: 0
2: 0
3: 30
4: 267
Right 920674611 1:208030416-208030438 GGGGATGCTCCAAAGCAAAGGGG 0: 1
1: 0
2: 0
3: 25
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920674611 Original CRISPR GGGGATGCTCCAAAGCAAAG GGG Intronic