ID: 920674612

View in Genome Browser
Species Human (GRCh38)
Location 1:208030421-208030443
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 191}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920674607_920674612 -5 Left 920674607 1:208030403-208030425 CCAGCGCTGGGCCGGGGATGCTC 0: 1
1: 0
2: 1
3: 20
4: 181
Right 920674612 1:208030421-208030443 TGCTCCAAAGCAAAGGGGACAGG 0: 1
1: 0
2: 0
3: 18
4: 191
920674606_920674612 -4 Left 920674606 1:208030402-208030424 CCCAGCGCTGGGCCGGGGATGCT 0: 1
1: 1
2: 1
3: 20
4: 161
Right 920674612 1:208030421-208030443 TGCTCCAAAGCAAAGGGGACAGG 0: 1
1: 0
2: 0
3: 18
4: 191
920674597_920674612 12 Left 920674597 1:208030386-208030408 CCCTGAAGTGCCCTCTCCCAGCG 0: 1
1: 0
2: 1
3: 13
4: 169
Right 920674612 1:208030421-208030443 TGCTCCAAAGCAAAGGGGACAGG 0: 1
1: 0
2: 0
3: 18
4: 191
920674604_920674612 1 Left 920674604 1:208030397-208030419 CCTCTCCCAGCGCTGGGCCGGGG 0: 1
1: 1
2: 5
3: 48
4: 431
Right 920674612 1:208030421-208030443 TGCTCCAAAGCAAAGGGGACAGG 0: 1
1: 0
2: 0
3: 18
4: 191
920674596_920674612 13 Left 920674596 1:208030385-208030407 CCCCTGAAGTGCCCTCTCCCAGC 0: 1
1: 0
2: 3
3: 30
4: 271
Right 920674612 1:208030421-208030443 TGCTCCAAAGCAAAGGGGACAGG 0: 1
1: 0
2: 0
3: 18
4: 191
920674602_920674612 2 Left 920674602 1:208030396-208030418 CCCTCTCCCAGCGCTGGGCCGGG 0: 1
1: 1
2: 1
3: 26
4: 320
Right 920674612 1:208030421-208030443 TGCTCCAAAGCAAAGGGGACAGG 0: 1
1: 0
2: 0
3: 18
4: 191
920674598_920674612 11 Left 920674598 1:208030387-208030409 CCTGAAGTGCCCTCTCCCAGCGC No data
Right 920674612 1:208030421-208030443 TGCTCCAAAGCAAAGGGGACAGG 0: 1
1: 0
2: 0
3: 18
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type