ID: 920674616

View in Genome Browser
Species Human (GRCh38)
Location 1:208030448-208030470
Sequence TGCTGTCCAGGGAATGCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 265}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920674608_920674616 11 Left 920674608 1:208030414-208030436 CCGGGGATGCTCCAAAGCAAAGG 0: 1
1: 0
2: 0
3: 16
4: 162
Right 920674616 1:208030448-208030470 TGCTGTCCAGGGAATGCAGATGG 0: 1
1: 0
2: 2
3: 22
4: 265
920674604_920674616 28 Left 920674604 1:208030397-208030419 CCTCTCCCAGCGCTGGGCCGGGG 0: 1
1: 1
2: 5
3: 48
4: 431
Right 920674616 1:208030448-208030470 TGCTGTCCAGGGAATGCAGATGG 0: 1
1: 0
2: 2
3: 22
4: 265
920674602_920674616 29 Left 920674602 1:208030396-208030418 CCCTCTCCCAGCGCTGGGCCGGG 0: 1
1: 1
2: 1
3: 26
4: 320
Right 920674616 1:208030448-208030470 TGCTGTCCAGGGAATGCAGATGG 0: 1
1: 0
2: 2
3: 22
4: 265
920674613_920674616 0 Left 920674613 1:208030425-208030447 CCAAAGCAAAGGGGACAGGCATG 0: 1
1: 0
2: 4
3: 13
4: 256
Right 920674616 1:208030448-208030470 TGCTGTCCAGGGAATGCAGATGG 0: 1
1: 0
2: 2
3: 22
4: 265
920674606_920674616 23 Left 920674606 1:208030402-208030424 CCCAGCGCTGGGCCGGGGATGCT 0: 1
1: 1
2: 1
3: 20
4: 161
Right 920674616 1:208030448-208030470 TGCTGTCCAGGGAATGCAGATGG 0: 1
1: 0
2: 2
3: 22
4: 265
920674607_920674616 22 Left 920674607 1:208030403-208030425 CCAGCGCTGGGCCGGGGATGCTC 0: 1
1: 0
2: 1
3: 20
4: 181
Right 920674616 1:208030448-208030470 TGCTGTCCAGGGAATGCAGATGG 0: 1
1: 0
2: 2
3: 22
4: 265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920674616 Original CRISPR TGCTGTCCAGGGAATGCAGA TGG Intronic