ID: 920674617

View in Genome Browser
Species Human (GRCh38)
Location 1:208030452-208030474
Sequence GTCCAGGGAATGCAGATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 374
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 342}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920674613_920674617 4 Left 920674613 1:208030425-208030447 CCAAAGCAAAGGGGACAGGCATG 0: 1
1: 0
2: 4
3: 13
4: 256
Right 920674617 1:208030452-208030474 GTCCAGGGAATGCAGATGGAAGG 0: 1
1: 0
2: 2
3: 29
4: 342
920674607_920674617 26 Left 920674607 1:208030403-208030425 CCAGCGCTGGGCCGGGGATGCTC 0: 1
1: 0
2: 1
3: 20
4: 181
Right 920674617 1:208030452-208030474 GTCCAGGGAATGCAGATGGAAGG 0: 1
1: 0
2: 2
3: 29
4: 342
920674608_920674617 15 Left 920674608 1:208030414-208030436 CCGGGGATGCTCCAAAGCAAAGG 0: 1
1: 0
2: 0
3: 16
4: 162
Right 920674617 1:208030452-208030474 GTCCAGGGAATGCAGATGGAAGG 0: 1
1: 0
2: 2
3: 29
4: 342
920674606_920674617 27 Left 920674606 1:208030402-208030424 CCCAGCGCTGGGCCGGGGATGCT 0: 1
1: 1
2: 1
3: 20
4: 161
Right 920674617 1:208030452-208030474 GTCCAGGGAATGCAGATGGAAGG 0: 1
1: 0
2: 2
3: 29
4: 342

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920674617 Original CRISPR GTCCAGGGAATGCAGATGGA AGG Intronic