ID: 920680630

View in Genome Browser
Species Human (GRCh38)
Location 1:208069744-208069766
Sequence AGATATAACCAGAGGAAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 206}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920680630_920680633 -2 Left 920680630 1:208069744-208069766 CCTATCTTCCTCTGGTTATATCT 0: 1
1: 0
2: 2
3: 27
4: 206
Right 920680633 1:208069765-208069787 CTCCAGGCTGATAGAGATAGCGG 0: 1
1: 0
2: 0
3: 12
4: 148
920680630_920680637 18 Left 920680630 1:208069744-208069766 CCTATCTTCCTCTGGTTATATCT 0: 1
1: 0
2: 2
3: 27
4: 206
Right 920680637 1:208069785-208069807 CGGGAAAGAAGCCAGAAGCAGGG 0: 1
1: 0
2: 1
3: 52
4: 365
920680630_920680636 17 Left 920680630 1:208069744-208069766 CCTATCTTCCTCTGGTTATATCT 0: 1
1: 0
2: 2
3: 27
4: 206
Right 920680636 1:208069784-208069806 GCGGGAAAGAAGCCAGAAGCAGG 0: 1
1: 0
2: 1
3: 29
4: 285
920680630_920680634 -1 Left 920680630 1:208069744-208069766 CCTATCTTCCTCTGGTTATATCT 0: 1
1: 0
2: 2
3: 27
4: 206
Right 920680634 1:208069766-208069788 TCCAGGCTGATAGAGATAGCGGG 0: 1
1: 0
2: 0
3: 3
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920680630 Original CRISPR AGATATAACCAGAGGAAGAT AGG (reversed) Intronic
902757555 1:18558873-18558895 AGCTAAACCCAGAGAAAGATTGG + Intergenic
903010760 1:20328514-20328536 AGATCTAAGAAGAGGAAGAGAGG + Intronic
905145596 1:35884544-35884566 AAAGATATCCAGTGGAAGATAGG - Intronic
905938106 1:41840760-41840782 CGACATAACCAGAGGAAGCTTGG + Intronic
906009098 1:42506586-42506608 AAATATAACCTAAAGAAGATTGG + Intronic
907832041 1:58073822-58073844 AGGTATAATTAGAGGAAGGTGGG + Intronic
908445827 1:64198767-64198789 AGATTTAAAAAGAGGAAGAAAGG + Intergenic
909019071 1:70411354-70411376 AGATATAACCAGTCGAAGCCGGG - Exonic
912063367 1:105702894-105702916 AGAGATAACCACAGCAAAATGGG + Intergenic
912527971 1:110298871-110298893 AGATAAAAACAGAGGAAAAGGGG + Intergenic
916028802 1:160858816-160858838 AAATATATCCAGAGAAAGAATGG + Intronic
917765790 1:178215283-178215305 AGATCTAACCAAGGGAACATGGG + Intronic
918405465 1:184207849-184207871 AGATATAACCTGGGGATGATGGG + Intergenic
920680630 1:208069744-208069766 AGATATAACCAGAGGAAGATAGG - Intronic
920752257 1:208690159-208690181 AGATATGACCAGAGGAGGTTGGG - Intergenic
921922120 1:220681930-220681952 AAATATATTCAGAGGAATATTGG - Intergenic
923872127 1:238006821-238006843 AAATATAAACAGAGAAAGCTTGG - Intergenic
1064487749 10:15813370-15813392 AGATTAAACCAGAGGAAGAGAGG - Intronic
1067281277 10:44875084-44875106 AGCTATAAGAAGAGGTAGATGGG + Intergenic
1068582339 10:58755989-58756011 AAATAAATCCAGAGGAAAATGGG - Intronic
1072080670 10:92027153-92027175 ATTGATAACCAGAGGAACATTGG + Exonic
1072970810 10:100015875-100015897 AGAGATCGACAGAGGAAGATTGG + Intergenic
1074621374 10:115126839-115126861 ACATATAACTAAATGAAGATAGG + Intronic
1076045617 10:127292045-127292067 AAATATAACCAGAGGCACTTTGG - Intronic
1077535403 11:3121741-3121763 AGACATAATCAGGTGAAGATGGG + Intronic
1079430682 11:20386430-20386452 AGATATAAGGAAAGGAAGAAAGG + Intergenic
1080943017 11:36940287-36940309 AGATTTAAACTGAGGAAGTTTGG - Intergenic
1082697833 11:56391868-56391890 AGATTTAACCAGGAGAATATTGG + Intergenic
1085282119 11:75337968-75337990 ATATTTCACCAGAGGAAGAAGGG + Intronic
1085855117 11:80167565-80167587 AGAGAGCACCAGAGGAAGAAAGG - Intergenic
1087569630 11:99908968-99908990 ATATATAACCAGAGAAAAAACGG + Intronic
1087711927 11:101563915-101563937 AGAGATGACCAGAGGAAAACAGG + Intronic
1089890675 11:121877696-121877718 AGAAATAACCAATGGGAGATAGG + Intergenic
1089911302 11:122103305-122103327 AGATACAGACAGAGGAAGAAGGG + Intergenic
1094241163 12:28226472-28226494 AGAGATAAGCAGAGGAAAATAGG - Intronic
1096201909 12:49690004-49690026 AGCTATAAACACAGAAAGATTGG - Intronic
1098505584 12:71246731-71246753 AGATATTACCAGAAAAAGCTGGG + Intronic
1098506688 12:71260658-71260680 AGAAGTAACCAGAAGAAGCTTGG + Intronic
1098913478 12:76234031-76234053 AGATAGCACAAGAGGAAGAAAGG + Intergenic
1100552776 12:95662082-95662104 ACATACACACAGAGGAAGATTGG + Intronic
1101182582 12:102235442-102235464 AGAGAACACCAGAGGAATATTGG - Intergenic
1101628519 12:106470575-106470597 AGATAAAACCACAAAAAGATGGG - Intronic
1103047492 12:117749423-117749445 AGAAATAACGAGAGGAAGGCAGG + Intronic
1105203377 13:18198007-18198029 AGAAATAACCAGACCAAAATTGG - Intergenic
1105373450 13:19820968-19820990 AGAAATCACAAGAGGAAAATAGG + Intergenic
1105555721 13:21446868-21446890 AGATAAAATTAGAGGAAGAGTGG + Intronic
1105764251 13:23543582-23543604 AGACATAACAAGGGGAAAATTGG + Intergenic
1106027358 13:25967975-25967997 AGTTGTTGCCAGAGGAAGATGGG + Intronic
1106269846 13:28141816-28141838 GGATGTAAGCAGATGAAGATGGG + Intronic
1107090597 13:36475027-36475049 ATAAATAACAAGAGGAACATTGG - Intergenic
1108517127 13:51214111-51214133 GGAGTTAACCAGATGAAGATGGG + Intergenic
1110031387 13:70618900-70618922 GTATATAACCAAAGGAAAATAGG + Intergenic
1110953010 13:81519040-81519062 AAATATAACCTAAAGAAGATTGG + Intergenic
1113596003 13:111533450-111533472 AGATATGAGCATTGGAAGATGGG + Intergenic
1116562389 14:46397260-46397282 TGAGATAAGCAGAGGAAGGTAGG - Intergenic
1118010514 14:61605959-61605981 AGATAGATCCAGAAAAAGATGGG + Intronic
1118475016 14:66108731-66108753 AGATATCATCACAGGAAAATAGG + Intergenic
1119005725 14:70926040-70926062 GGATATAACTAGATGGAGATGGG - Intronic
1119995758 14:79252010-79252032 AAATGTAACCTGGGGAAGATAGG - Intronic
1120352356 14:83379059-83379081 AAATATATACAGAGGAAGGTTGG - Intergenic
1122451303 14:101810157-101810179 AGACTTAACCAGAGGAGGTTGGG + Intronic
1122565876 14:102655624-102655646 ACATACAACCAGTGGGAGATAGG - Intronic
1126366289 15:47898112-47898134 AGATATGACCAGTGGAAGTTAGG + Intergenic
1126973704 15:54149591-54149613 AGAAATTAACAAAGGAAGATTGG - Intronic
1127174168 15:56336419-56336441 AGATATTACCAGAGAAATATTGG - Intronic
1130367640 15:83254565-83254587 AGATATGACCACATGAAGATGGG + Intergenic
1133088805 16:3387357-3387379 AGATATAAACAGATAGAGATGGG - Intronic
1135915079 16:26598147-26598169 GGAGATAACCAGAGGCAGAGGGG - Intergenic
1138653041 16:58472625-58472647 TGATACAAAGAGAGGAAGATGGG + Intronic
1139372377 16:66477137-66477159 GGATTTAACCAGGGGAAGAGGGG - Intronic
1139785445 16:69388588-69388610 TGGGATAACCAGAGGATGATGGG + Intronic
1141190101 16:81818489-81818511 AGATGCAAGCAGAGGAAGAATGG - Intronic
1143276256 17:5713240-5713262 AGTTCTAACCAGAGGAATATGGG + Intergenic
1143303396 17:5927641-5927663 GGATTTAAGCAGAGGAAGGTTGG + Intronic
1143601675 17:7950610-7950632 ATATATACCCAAAGGAAAATAGG + Intergenic
1143684681 17:8504347-8504369 AGATAGGACCAGAGGGAGAAGGG - Intronic
1145101121 17:20078538-20078560 AGAGAGAATCATAGGAAGATGGG + Intronic
1147761548 17:42800670-42800692 GGATTAAACCAGAGGGAGATGGG + Intronic
1149094698 17:52826594-52826616 AAATATAACCTAAAGAAGATTGG + Intergenic
1150702434 17:67459559-67459581 AAATATAACCCCAGGAAGAAAGG - Intronic
1153704827 18:7734828-7734850 ATAAATACCCAGAGGAAGACAGG - Intronic
1155172768 18:23279303-23279325 AGATATAAGCAGAAGTTGATGGG - Intronic
1156556576 18:38075251-38075273 AGGTCTGAGCAGAGGAAGATGGG - Intergenic
1156616875 18:38797297-38797319 ACATATAACAAGAGGAAAATGGG - Intergenic
1156859952 18:41824315-41824337 AGGGATAACAAGAGGAAGCTAGG + Intergenic
1157943204 18:51951552-51951574 AGAAATACCCAGATGAAGGTTGG + Intergenic
1159053358 18:63442138-63442160 AGACATCAACAGAAGAAGATAGG + Intergenic
1159934153 18:74348332-74348354 AGATATAACCACAGGTTTATAGG - Intronic
1160221630 18:76982157-76982179 AGCTATAAAGAGAGGATGATAGG - Intronic
1164150551 19:22546715-22546737 AGACAGAACCAAAGGAAGAAGGG + Intergenic
1165011940 19:32854937-32854959 ATATATACCCAGAGGTACATAGG - Intronic
1165618092 19:37219704-37219726 AGAGTTACCCAGAGGAAGAATGG + Intronic
1166053450 19:40274783-40274805 AGATGTAGCTAGAGGAAGCTGGG + Intronic
1166161832 19:40959818-40959840 AGATAGCACCAGGGGGAGATGGG - Intergenic
1166161867 19:40960129-40960151 AGATATCACCAGGGAGAGATGGG - Intergenic
1168045897 19:53793999-53794021 AGATCTGGACAGAGGAAGATGGG - Exonic
1168495613 19:56846323-56846345 GGATAAAACCATAGGAATATTGG - Intergenic
927585483 2:24299933-24299955 AGAGACAACGAGAGGAAGAAAGG - Exonic
928395995 2:30943760-30943782 AGAGATACCAAGAGGAAAATTGG - Intronic
929354871 2:41009838-41009860 ACAAATAACCAGATTAAGATGGG - Intergenic
929377087 2:41300324-41300346 AGATATATTTAGAAGAAGATGGG + Intergenic
930897607 2:56464057-56464079 AGAGCTACTCAGAGGAAGATGGG - Intergenic
931179018 2:59881323-59881345 AGATAGGACCAGAGGAAGATGGG - Intergenic
931884396 2:66599909-66599931 AGATATGCCCACAGGAAGCTAGG - Intergenic
932549712 2:72755623-72755645 AGAAAGAAACAGAGGAAGAAAGG + Intronic
932983610 2:76699419-76699441 AGATATAAATATAGTAAGATGGG + Intergenic
934629058 2:95895420-95895442 AAATATAACCAGAGAAAGAAAGG - Intronic
934629472 2:95901036-95901058 AAATATAACCAGAGAAAGAAAGG - Intronic
934629887 2:95906652-95906674 AAATATAACCAGAGAAAGAAAGG - Intronic
934803622 2:97194874-97194896 GAATATAACCAGAGGAAAAAAGG + Exonic
936593672 2:113827482-113827504 AGTCATAACTAGAGGAAGAGAGG + Intergenic
938129424 2:128698770-128698792 TGATATAACCGGAGGAAAACTGG + Intergenic
938617815 2:133017974-133017996 AGATAGAGACTGAGGAAGATTGG - Intronic
940049074 2:149441873-149441895 ACATGCAACCAGAGGAAAATTGG - Intronic
940391658 2:153139576-153139598 AGATATGAACAGATGGAGATGGG + Intergenic
942860114 2:180599143-180599165 AAATACAACCATAGGCAGATTGG + Intergenic
943184206 2:184585634-184585656 ATATATACCCAGAAGAATATAGG - Intergenic
946201752 2:218074608-218074630 AGAAATGAACAGAGGAACATGGG + Intronic
947354372 2:229276791-229276813 AAATAGAAGCAAAGGAAGATTGG - Intergenic
947515128 2:230796962-230796984 AGATCTAATAAGAGGAAGACTGG + Intronic
948471375 2:238182767-238182789 AGAAATAGCAAGAGGAAAATTGG - Intronic
948791953 2:240383733-240383755 AGAAAGAACAAAAGGAAGATGGG - Intergenic
1170655477 20:18283495-18283517 GGATATAACCAGAGTAAATTTGG + Intergenic
1170748457 20:19122016-19122038 AGATATAGATAGATGAAGATGGG - Intergenic
1173756766 20:45523306-45523328 AGACACAACCAGAGGAAGATGGG - Intergenic
1174882517 20:54296073-54296095 AGATATAAGATCAGGAAGATAGG - Intergenic
1175858660 20:62137183-62137205 CCATCTAATCAGAGGAAGATGGG + Intronic
1176714587 21:10340011-10340033 AGAAATAACCAGACCAAAATTGG + Intergenic
1181658823 22:24324926-24324948 AGATATAACCAGAGCGAGAATGG + Intronic
949486738 3:4546869-4546891 AGATAGGACCAGGGGAAGAGAGG + Intronic
949890716 3:8731909-8731931 AGATATAAACAGAAGTAGTTGGG + Intronic
950168748 3:10821467-10821489 AAGTGTAACCAGAGGAAAATGGG + Intronic
950186172 3:10947039-10947061 AGATGTGGCCAGAGGGAGATGGG + Intergenic
951168983 3:19516773-19516795 AGATATAGCTAGAGAAAGAGTGG - Intronic
952180476 3:30911475-30911497 AGAAGTGACCAGAGGAAGAGAGG - Intergenic
952848182 3:37706085-37706107 AAATGAAACCAGAGGAAGTTTGG + Intronic
953688220 3:45094767-45094789 GGATCTCACAAGAGGAAGATTGG + Intronic
954249249 3:49355506-49355528 AGAGAGAACCAGAGGGAGGTGGG + Intergenic
955434307 3:58885222-58885244 AGATGTTAACAGAGGAAGCTGGG - Intronic
956542063 3:70351159-70351181 AGAGAAAAGCATAGGAAGATTGG + Intergenic
957383554 3:79466889-79466911 GAATATATCCAGAGGAAGCTTGG + Intronic
959275714 3:104275165-104275187 ATATATAACCTAAAGAAGATTGG + Intergenic
961512992 3:127414448-127414470 AGAAAGAGCCAGAGGAAGACAGG - Intergenic
961866435 3:129956784-129956806 AGCCATAACCAGAGGCAGAAGGG + Intergenic
965008103 3:163052387-163052409 ATATATATCCTGAAGAAGATTGG + Intergenic
965427593 3:168546543-168546565 AGATAAAACCAGGGGATAATGGG - Intergenic
967526286 3:190497544-190497566 AGATATCACAGAAGGAAGATGGG - Intergenic
967993219 3:195147167-195147189 AGATATAACGTGAGGGAGATAGG - Intronic
969043134 4:4316749-4316771 GCATATAACCAGAGGAAACTCGG + Intronic
969923100 4:10559340-10559362 AGATATAACCAAAAGAAGAAGGG - Intronic
970439021 4:16063895-16063917 AGGTAGAACCAGAGTAAGACTGG + Intronic
971968992 4:33597549-33597571 AAATATAACCAAAACAAGATTGG - Intergenic
972106055 4:35489081-35489103 AGAAATAACCAGAATAAAATAGG + Intergenic
975120426 4:70722285-70722307 AGATAAAAGGAGAGGAAGCTGGG + Exonic
977669324 4:99677668-99677690 AGAAATAAGCAGAGGAAGTTGGG - Intergenic
979266445 4:118708713-118708735 AGAAATAACCTAAGGATGATGGG + Intronic
980272932 4:130610552-130610574 ATCTATAATCAGAGGAAGAAAGG + Intergenic
980301360 4:130998579-130998601 AGATATAACTTAAAGAAGATTGG - Intergenic
981490912 4:145338341-145338363 AGATATCAGAAAAGGAAGATGGG + Intergenic
984107559 4:175568582-175568604 AGAAATCAGCAGATGAAGATTGG + Intergenic
984197063 4:176670923-176670945 AGAGATCACCAGGGGAAGTTAGG + Intergenic
984500447 4:180551818-180551840 TTATCTAACCAGAGGAATATAGG - Intergenic
985303818 4:188517426-188517448 AGAGTGAACCAGAGGTAGATAGG + Intergenic
985760982 5:1748574-1748596 AGATATAAACAGCGGATGAAGGG + Intergenic
989068780 5:37489544-37489566 AGATATAAGCAGTGGTAGACTGG + Intronic
993488312 5:88514339-88514361 AGAAATAAACAGAGGAAGGGAGG + Intergenic
994968884 5:106709845-106709867 AGATATAATCAGAGTAATACTGG - Intergenic
995734435 5:115284638-115284660 AAATATAACAAGAGAAAGATGGG - Intronic
995814566 5:116152745-116152767 AAAAATAACCAAAGGAAAATGGG - Intronic
998926647 5:147134147-147134169 AGATATCACCAGAGGTAAAGAGG - Intergenic
999716285 5:154363162-154363184 AGAAATAAGCATAAGAAGATTGG + Intronic
1003241236 6:4347437-4347459 ACAGAGAACCAGAGGAAGAAAGG - Intergenic
1004986144 6:21085104-21085126 AGAGTTATCCAGGGGAAGATTGG + Intronic
1005261716 6:24068229-24068251 AGAGAGAGGCAGAGGAAGATTGG + Intergenic
1006418898 6:33921376-33921398 AAATTAAACCAGAGGAAAATTGG + Intergenic
1008034519 6:46732266-46732288 AGATGAAACCTCAGGAAGATGGG - Intronic
1008059407 6:46981441-46981463 AAATATAGCCAGAGGAAAAGAGG - Intergenic
1008374852 6:50779884-50779906 AGTTATCTCCAGAGGAAGAGTGG + Intergenic
1009797462 6:68490126-68490148 AAATATAAACAGAGAGAGATAGG - Intergenic
1015710836 6:136138410-136138432 AGATATAAGAAGCTGAAGATGGG - Intronic
1019481031 7:1266974-1266996 AGAGTTAACCAGTGGAAGAGAGG - Intergenic
1019959217 7:4444464-4444486 ATCTATAACCAGAGAAAGAAAGG - Intergenic
1020381301 7:7549900-7549922 ACATATATCCACAGGGAGATGGG - Intergenic
1020482400 7:8678488-8678510 AGCAACAACCAGAGGAAGCTAGG - Intronic
1021288121 7:18807732-18807754 ATCAATAACCAGAGGAAAATTGG - Intronic
1021292568 7:18864438-18864460 AGATCTGACCAGGGGAAAATGGG + Intronic
1022059935 7:26783397-26783419 AGAGATAATCAGAGAAATATTGG - Intronic
1022397067 7:29998801-29998823 AGATATAAGCAGGGGAAGAAAGG - Intergenic
1023101348 7:36721606-36721628 AGAGTTAACCAGAAGAAGTTGGG + Intronic
1023306431 7:38833448-38833470 AGAGAGAACCAGGGGAAGAGGGG - Intronic
1023585100 7:41721214-41721236 AGATGTTGCCAGAGGGAGATTGG - Intergenic
1023706120 7:42943438-42943460 AGCAATAGCTAGAGGAAGATAGG + Intronic
1024115190 7:46186216-46186238 AAATATAACCAGAGAAAGCTAGG - Intergenic
1025972307 7:66338651-66338673 ATCTATAATCAGAGGAACATTGG + Intronic
1027803560 7:82785845-82785867 TGATATAACCAGATGTAAATTGG + Intronic
1027808550 7:82861805-82861827 AGAAATAACCAGAGGAATTTTGG + Intronic
1028286184 7:89004286-89004308 AGATATAGCCAAAGTCAGATGGG - Intronic
1028482394 7:91321795-91321817 AGGTATTACCAGAGGAAGTTAGG - Intergenic
1031399148 7:121310828-121310850 AAAGATAACCAGAGGAAAAAAGG + Intergenic
1031427408 7:121622607-121622629 AGATATAACAATAGTAAGATTGG - Intergenic
1032354454 7:131197041-131197063 AGAATTAAACAGAGGAGGATGGG - Intronic
1032416448 7:131738763-131738785 AGGGATGACCAGAGGAAGAAGGG + Intergenic
1032619108 7:133509441-133509463 AAATATAAGCAGAGGTAGTTGGG + Intronic
1036761413 8:11511613-11511635 AGAGATTCCCAGAGGAAGAAAGG - Intronic
1038280964 8:26164321-26164343 AGTTAAAAACAGAGGAAGATGGG + Intergenic
1038365041 8:26922989-26923011 ATGAAGAACCAGAGGAAGATGGG + Intergenic
1039029211 8:33291627-33291649 AGATATGAGCAGAGGAGGTTGGG - Intergenic
1039192807 8:34996136-34996158 ATATATACCCAAAGGAAAATAGG - Intergenic
1042358067 8:67851492-67851514 AGATGTAACCAGAGGCTTATAGG + Intergenic
1043028462 8:75101855-75101877 AAATATAACAATAGGTAGATAGG - Intergenic
1046853872 8:119007021-119007043 AGGTATAACTAGAGGAAGAATGG - Intronic
1048771019 8:137895349-137895371 TGATATAAAGAGAAGAAGATAGG - Intergenic
1051778262 9:20659474-20659496 AGATATAAGAAGAGGAAGTTTGG + Intronic
1052489693 9:29149811-29149833 AGAGCTACTCAGAGGAAGATGGG - Intergenic
1056321753 9:85441771-85441793 TGATGTAAGCAGAGGAATATTGG - Intergenic
1056336968 9:85581225-85581247 AGGCATAACCATAGGAAGAGAGG + Intronic
1056710192 9:88986265-88986287 AGATGTAACCAGGGAAAGAAAGG + Intergenic
1059044278 9:110847886-110847908 AGATAAAGAAAGAGGAAGATGGG + Intergenic
1059780554 9:117521873-117521895 AGCCATAAACAGAGGAAGCTGGG - Intergenic
1062217930 9:135399219-135399241 AGAGATTTCCAGAGGAAGATGGG + Intergenic
1185829886 X:3290809-3290831 AGATATAACTATGGGAAGAGAGG + Intergenic
1186162281 X:6790127-6790149 AGATATATACAGATGTAGATAGG + Intergenic
1187833851 X:23410606-23410628 ATGTATGACCAGAGGAAGACAGG - Intergenic
1188554422 X:31395947-31395969 AGATATAGCCAGATGAATTTAGG + Intronic
1188896426 X:35674372-35674394 AGATATAATTAGAAGAAAATTGG - Intergenic
1190138477 X:47818974-47818996 AGATATGAGCAGAAGAGGATAGG + Intergenic
1190824284 X:54002721-54002743 GGAGATAATCAGAGGAAGAAAGG - Intronic
1191745960 X:64486931-64486953 ATATATACCCAAAGGAATATAGG - Intergenic
1193943155 X:87701821-87701843 AGATAGAATGAGAGAAAGATTGG + Intergenic
1194368424 X:93038388-93038410 AGATATATCTAGAGGAACAGTGG + Intergenic
1196364427 X:114907892-114907914 ACATATAAACACAGTAAGATAGG + Exonic
1197968906 X:132094407-132094429 AGAAACCACCAGAGGATGATTGG - Intronic
1198105912 X:133461158-133461180 AGATATATCCAGAGGTTTATGGG + Intergenic
1199436398 X:147818114-147818136 AGATATAACCCTGGGAAAATAGG - Intergenic
1199579095 X:149343761-149343783 ACAAAAAAGCAGAGGAAGATTGG + Intergenic
1200676629 Y:6154666-6154688 AGATATATCTAGAGGAACAGTGG + Intergenic