ID: 920682598

View in Genome Browser
Species Human (GRCh38)
Location 1:208084280-208084302
Sequence CCTGGAAGGCTCCGGAAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 237}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920682590_920682598 12 Left 920682590 1:208084245-208084267 CCTGCATCCCTGGGGATGTGGGC 0: 1
1: 0
2: 0
3: 30
4: 316
Right 920682598 1:208084280-208084302 CCTGGAAGGCTCCGGAAGCCAGG 0: 1
1: 0
2: 1
3: 22
4: 237
920682592_920682598 4 Left 920682592 1:208084253-208084275 CCTGGGGATGTGGGCTCAGCCTG 0: 1
1: 0
2: 3
3: 35
4: 366
Right 920682598 1:208084280-208084302 CCTGGAAGGCTCCGGAAGCCAGG 0: 1
1: 0
2: 1
3: 22
4: 237
920682591_920682598 5 Left 920682591 1:208084252-208084274 CCCTGGGGATGTGGGCTCAGCCT 0: 1
1: 0
2: 5
3: 45
4: 291
Right 920682598 1:208084280-208084302 CCTGGAAGGCTCCGGAAGCCAGG 0: 1
1: 0
2: 1
3: 22
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920682598 Original CRISPR CCTGGAAGGCTCCGGAAGCC AGG Intronic
900120170 1:1045469-1045491 CCTCGAAAGTTCCAGAAGCCAGG - Exonic
900207013 1:1435927-1435949 GCTGGGAGGCTGCGGGAGCCGGG + Intronic
900384152 1:2401733-2401755 CCTGGAAGCCACCAGAAGCTTGG + Intronic
900658938 1:3773280-3773302 CCTGGGAGGCTCCCGGATCCTGG - Intronic
901142847 1:7046395-7046417 TCTGGAAGCCTCCGGCAGCTGGG - Intronic
901358871 1:8678046-8678068 CCTGCAGCCCTCCGGAAGCCTGG + Intronic
901810471 1:11764449-11764471 CCTGCAGCGCTCCCGAAGCCAGG + Exonic
902792859 1:18780910-18780932 CCTGGAAGGCTCAGGAATGTAGG - Intergenic
903927347 1:26840018-26840040 CCTGGCAGCCTCAGGAAGCCGGG + Intronic
905339043 1:37265840-37265862 CCTAAAAGCCTCCTGAAGCCAGG + Intergenic
905410117 1:37762820-37762842 CCTGGGAGGCTTTGGAATCCAGG + Exonic
906105995 1:43292999-43293021 GCTGGAAGAGGCCGGAAGCCTGG - Intergenic
906178946 1:43801451-43801473 TCTTGAAGGTTCCTGAAGCCAGG - Intronic
906213274 1:44024153-44024175 CTTGGAAGGCTTAGGAAGGCCGG - Intronic
906960400 1:50416371-50416393 GCTGGGAGGCTCCGAAAACCTGG + Intergenic
915065139 1:153218613-153218635 CCTGGAATGCTAAGGAAGCCAGG - Exonic
915449349 1:155993984-155994006 CCCAGAAGGATCAGGAAGCCGGG + Intronic
918725482 1:187916503-187916525 CCTGCAGGGCACCAGAAGCCAGG + Intergenic
920388362 1:205583410-205583432 ACTGGAAGGATCAGGATGCCAGG + Intronic
920682598 1:208084280-208084302 CCTGGAAGGCTCCGGAAGCCAGG + Intronic
920948719 1:210553371-210553393 TCTGGAAGGCTCCTGAATCTAGG - Intronic
921079978 1:211731360-211731382 GCTGGCAGGCACCAGAAGCCAGG + Intergenic
922183768 1:223256620-223256642 CCTGGCTGGCTCTGGAAGGCAGG - Intronic
922352809 1:224748114-224748136 CCTGGAAGAGGCCAGAAGCCTGG + Intergenic
922549607 1:226484362-226484384 CCTGGAAGGCTAAGCAAGGCTGG - Intergenic
922619939 1:226983182-226983204 CCTGGACGGCACCAGAAGCTTGG + Intronic
922916301 1:229260378-229260400 CCAGTAAGGCACCAGAAGCCAGG + Intergenic
923009050 1:230073829-230073851 CCTGGAAGGCTGCGGCAGAAGGG - Intronic
923091414 1:230743932-230743954 CCAGGAAGGCCCCAGATGCCAGG + Intergenic
1067099396 10:43323443-43323465 CCGTGAAGGCTCAGGAAGCGCGG - Intergenic
1067142856 10:43670810-43670832 CCTGGAAATGTCCAGAAGCCTGG + Intergenic
1067205150 10:44206665-44206687 CCGGCAAGGCTCCCCAAGCCCGG + Intergenic
1068248925 10:54410425-54410447 ACTGGAAAGCTCTGGAAGCTGGG + Intronic
1068378793 10:56220177-56220199 CCCGGAAGACTACAGAAGCCTGG - Intergenic
1069915129 10:71782634-71782656 CCTTGAAGGCTCAGGGAGGCAGG - Intronic
1070797685 10:79226377-79226399 GCAGGAAGGCTCGGGAAGGCAGG - Intronic
1073583294 10:104686556-104686578 CCAGGAAGACTCAGGAACCCTGG + Intronic
1073698111 10:105893594-105893616 CCTGGAAAGGGCCTGAAGCCAGG + Intergenic
1074931288 10:118128781-118128803 TCTGGAGGGCTCTGAAAGCCAGG - Intergenic
1076623041 10:131805083-131805105 ACTGGGAGTCCCCGGAAGCCGGG + Intergenic
1077268880 11:1665918-1665940 CCTAGGAGGCCCAGGAAGCCTGG + Intergenic
1077271872 11:1685262-1685284 CCTAGGAGGCCCAGGAAGCCTGG - Intergenic
1077393895 11:2311906-2311928 CCTGGAGGGCCCTGGAGGCCGGG - Intronic
1078480753 11:11673202-11673224 CCTGCAAGGCTAAGGATGCCAGG - Intergenic
1079078739 11:17399162-17399184 CTTGGGAGGCTGAGGAAGCCAGG + Intronic
1083775659 11:64893344-64893366 CCTAGGAGGCTCCTGAACCCAGG - Intergenic
1083897719 11:65628527-65628549 CATGGAAGCCCCCGGATGCCAGG - Intronic
1084270574 11:68027149-68027171 CCTCTAAGGCTCCCCAAGCCTGG + Intronic
1084501789 11:69539510-69539532 TCTGGAAGGCTCCAAAAACCTGG + Intergenic
1084682955 11:70677718-70677740 TGTTGAGGGCTCCGGAAGCCAGG + Intronic
1084952062 11:72671896-72671918 CATGGAAGGCTCAGGAAAGCTGG - Intronic
1089007589 11:115105421-115105443 CCTGGAAGTCATAGGAAGCCAGG + Intergenic
1090076126 11:123581067-123581089 CCGCGAAGGCTCCGGGAGTCTGG - Intronic
1090114680 11:123956043-123956065 CCTGGAAGACTGGGGAAGCCAGG - Intergenic
1093685177 12:22046540-22046562 TCTGGAAGGCCCCTGAATCCAGG - Exonic
1094039196 12:26105093-26105115 GCAGGAAGTCTCCAGAAGCCAGG - Intergenic
1098204909 12:68098464-68098486 CCTGGCAATCACCGGAAGCCAGG - Intergenic
1100464712 12:94834761-94834783 ACTGGAAGGATGCTGAAGCCTGG + Intergenic
1101735730 12:107461448-107461470 TCTGGGAGCCTCCAGAAGCCAGG + Intronic
1103339766 12:120215215-120215237 CCTGGGGGGCCCCCGAAGCCCGG - Exonic
1103410906 12:120710759-120710781 CGCTGAAGGCTCCGGGAGCCGGG - Intronic
1103623909 12:122204630-122204652 CCTGGTGGGCTGCGGAAGGCTGG - Exonic
1104836553 12:131795683-131795705 CCTGGAAGGCAGAGGAGGCCAGG + Intronic
1106314078 13:28578267-28578289 GCTGGAAGGCACAGGAAGCAGGG + Intergenic
1110850687 13:80241395-80241417 CCTGGAAGCCTGGAGAAGCCAGG + Intergenic
1111289162 13:86140798-86140820 CCTGGAGGGCTGGGGATGCCAGG - Intergenic
1113458493 13:110465558-110465580 CCAGGAGGGCCCAGGAAGCCTGG - Exonic
1113731403 13:112644308-112644330 CCTGGGAGACTCCGGGAGCAGGG - Intergenic
1118309210 14:64680420-64680442 CCAGGGAGGCTTCGGGAGCCAGG - Intergenic
1119428820 14:74552493-74552515 CCTAGATGGCTCCTGTAGCCCGG + Intronic
1121909651 14:97777273-97777295 CCTGCAAGGCTGTGGGAGCCGGG + Intergenic
1122236999 14:100336979-100337001 CCTGGAAGGCTCCAACAGCCAGG - Intronic
1124145774 15:27123963-27123985 CAGGGAAGGCTCCGGCCGCCTGG - Intronic
1124438623 15:29671215-29671237 TCTGGAAGGGTCCGGAGCCCAGG - Intergenic
1124788263 15:32701919-32701941 CTTTGAAGCCTCCTGAAGCCTGG + Intergenic
1128811988 15:70579656-70579678 CCTGGAAGTCACAGGAATCCAGG + Intergenic
1129272967 15:74429025-74429047 CCTGCAAGGGTACGGAACCCTGG + Intronic
1129385145 15:75192257-75192279 CCTGGCTGGCTGGGGAAGCCAGG - Intergenic
1129412269 15:75356506-75356528 CCTAGAAGGGGCAGGAAGCCAGG + Exonic
1129660998 15:77552853-77552875 CATGGAGGGCTGCGGAAGCAAGG - Intergenic
1130596916 15:85255160-85255182 CACGGAAGGCCTCGGAAGCCGGG - Intergenic
1131348438 15:91673088-91673110 CATTAAAGGCTCTGGAAGCCCGG + Intergenic
1132581435 16:686468-686490 CCTGGAGAGCTCCAGAAGCAAGG + Intronic
1133076192 16:3282998-3283020 CCTCGTCGGCTCCGGAAGCCAGG - Exonic
1138492564 16:57384795-57384817 CCTGGAAGGCTCTCCCAGCCTGG - Exonic
1138872960 16:60914902-60914924 TCTGGAAGACCCCGAAAGCCAGG + Intergenic
1142023920 16:87802138-87802160 CCTGGAAAGGTCCTGGAGCCCGG - Intergenic
1142028521 16:87827089-87827111 CCGGGAAGGTTCCTGAAGACAGG - Intergenic
1142385332 16:89760421-89760443 CCTGGAAGGCCCCTGATGGCCGG + Intronic
1142486068 17:248364-248386 CCTGGGAGGCTCAGGATGCAAGG - Intronic
1143056965 17:4169739-4169761 CCAGGCACTCTCCGGAAGCCTGG - Intronic
1143383091 17:6508506-6508528 CCAGGACGGCTCAGGCAGCCTGG + Intronic
1143541138 17:7570046-7570068 TCTGGCAGGCTCCAGAATCCTGG + Intronic
1143651199 17:8265159-8265181 TGTGGAAGGGTCCTGAAGCCCGG - Intronic
1143764609 17:9129304-9129326 CCTGGAAGGCCCCAGAGCCCAGG + Intronic
1144395216 17:14836712-14836734 GCAGGAAGCCTCCGGAAGCTGGG + Intergenic
1145042127 17:19584813-19584835 GCTGGAAGGATACTGAAGCCTGG - Intergenic
1150249770 17:63699271-63699293 CCTGGGCGGCTCCTGCAGCCTGG + Exonic
1150596807 17:66613594-66613616 GCTGGGAGGCCCCAGAAGCCAGG - Intronic
1150628778 17:66861596-66861618 CCTTGCAGGCTTCTGAAGCCTGG + Intronic
1150724888 17:67643618-67643640 CCTGGGAGGCTCCCAGAGCCAGG - Intronic
1150725314 17:67646890-67646912 GCTGGAAGTTTCAGGAAGCCTGG + Intronic
1152269043 17:79313178-79313200 CCTGGAAGGTGCCAGAAGCAAGG - Intronic
1152462888 17:80450571-80450593 TCTGGAGGGCCCTGGAAGCCAGG - Intergenic
1152675165 17:81636583-81636605 CCAGGAAGTCTCCTGGAGCCGGG + Intronic
1152682785 17:81677846-81677868 ACTGGAAGGCCTCAGAAGCCAGG + Intergenic
1156260134 18:35438713-35438735 TCTGGAAGGCCCAGGAAGCCAGG - Intergenic
1158663679 18:59412979-59413001 CCTGCAAACCTCCAGAAGCCAGG - Intergenic
1160533500 18:79578717-79578739 CCTGCAAGGCGCCCGCAGCCTGG - Intergenic
1160824952 19:1075085-1075107 CCTGGAAGGACCCAGGAGCCCGG + Intronic
1160921344 19:1522315-1522337 TCAGGAAGGAACCGGAAGCCAGG + Intergenic
1161000248 19:1907263-1907285 CCTGGAAGGCTGGGGAAGTAGGG - Intronic
1161055711 19:2189834-2189856 TCTGGAGGGGTCCGGGAGCCTGG - Intronic
1161773352 19:6243246-6243268 CCGGGAAGGCTCGGGGAGGCCGG + Intronic
1162680004 19:12333485-12333507 CCTGGAACATCCCGGAAGCCGGG - Exonic
1162749730 19:12821537-12821559 CCTGGAAGACACTGGATGCCAGG - Intronic
1163848497 19:19650640-19650662 CCTGGAAGACCCCGGTAGCTGGG + Intronic
1165427758 19:35755268-35755290 GCTGGTAGGGTCTGGAAGCCGGG + Exonic
1165549726 19:36573650-36573672 TCTGGAAAGAACCGGAAGCCCGG + Intronic
1165882712 19:39054832-39054854 GCTGGCAGCCTCCAGAAGCCAGG - Intergenic
1168078187 19:53991802-53991824 CCGGGAAGGCCCTGGGAGCCCGG + Intergenic
1168287802 19:55343057-55343079 CCTGGAAGCCCCAGGAACCCTGG - Intronic
1168354834 19:55694704-55694726 CCTGGAAGGATCCGGGAGAGGGG - Exonic
925405454 2:3603070-3603092 CCAGGAAGTATCCGGAAGCATGG + Intronic
925928125 2:8685207-8685229 GCTGGGAGGCTCTGGAAGGCGGG + Intergenic
925981927 2:9184206-9184228 CCGGGAAGGATCAGGCAGCCAGG - Intergenic
926818776 2:16828961-16828983 CCTGGAGAGCCCAGGAAGCCCGG + Intergenic
928282799 2:29963907-29963929 CCTGGCAGGCTCCAGGAGTCTGG - Intergenic
930021862 2:47006570-47006592 CCTGGAAGGGTGCGGATGGCTGG + Intronic
930127682 2:47815495-47815517 ACTGGAAGGCCTCAGAAGCCAGG - Intronic
931480372 2:62633449-62633471 CCTGGAAGGGGGCTGAAGCCAGG + Intergenic
933808684 2:86018402-86018424 AATGGAAGGCTACAGAAGCCTGG - Intergenic
934562217 2:95319305-95319327 ACTGGAAGGCCCAGGAACCCTGG - Intronic
937463756 2:122111505-122111527 CCTGGAAGTGTCCTGAAGCTGGG + Intergenic
942671038 2:178376722-178376744 GTTGGAAGGCTCCAGAAGACAGG - Intronic
943082039 2:183267223-183267245 ACTGGAAGGCCTCAGAAGCCAGG - Intergenic
945053575 2:205848881-205848903 CCTGGAGGCATCAGGAAGCCAGG - Intergenic
946185752 2:217979597-217979619 CCTATAAGGTTCCCGAAGCCTGG + Intronic
946847422 2:223871610-223871632 CTTGGAAGCCTCTGGAAGACAGG - Intronic
948120225 2:235524024-235524046 ACTGGAAGGATGGGGAAGCCGGG - Intronic
948352168 2:237350080-237350102 GCTGGAAGGTGCAGGAAGCCAGG - Intronic
948582415 2:238997102-238997124 CCTGGCAGGCTCGGGAGGGCAGG + Intergenic
948592643 2:239061008-239061030 CCAGGAAGGCTTTGGCAGCCCGG + Intronic
1169316311 20:4593398-4593420 CCAGGGAGGCTCCAGCAGCCTGG - Intergenic
1169352463 20:4880352-4880374 AAAGGAAGGCTCAGGAAGCCCGG - Intronic
1170738129 20:19028123-19028145 CCAGGAAAGCTCCAGGAGCCTGG - Intergenic
1172150851 20:32789345-32789367 CCTGGAAGAGACCGGAAGCATGG + Intronic
1172393659 20:34583746-34583768 CCTGGCAGGCTCCGGAACTCTGG - Intronic
1173165374 20:40683715-40683737 CCCTGGAGGCTCCGGAAGCCCGG + Intergenic
1174217609 20:48929099-48929121 CCTGGCAGGCCCCCTAAGCCTGG - Intronic
1174425861 20:50431108-50431130 GATGGAAGGTTCTGGAAGCCTGG - Intergenic
1175803708 20:61815485-61815507 CCAGGGAGGCTCCGGGAGACAGG + Intronic
1175900990 20:62359880-62359902 CCTGGAAGGCTGAGGAGGGCGGG - Intronic
1179101246 21:38357169-38357191 CCAGGAAGGCCTCAGAAGCCTGG - Intergenic
1179576010 21:42308904-42308926 TCTGGAAGGCTCTGGAAACACGG + Intergenic
1179734121 21:43382554-43382576 CCGGGAAGCCTCCGGAAGGATGG - Intergenic
1179908899 21:44437799-44437821 GCTGGAGGGCTGCGGAGGCCAGG - Intronic
1181320857 22:22004997-22005019 CCTGAAAGGCCCAGGAAGCTGGG + Intergenic
1182079417 22:27518554-27518576 CCTGGAAGGCTGCTGGAGGCTGG - Intergenic
1182756320 22:32682511-32682533 GGTGGAAGGCCCTGGAAGCCAGG + Intronic
951248005 3:20363666-20363688 CCTGGAAGGCTTGGGAAGTCAGG - Intergenic
955358805 3:58254721-58254743 CCTGGAAGGACCTGTAAGCCAGG - Intronic
955631759 3:60982201-60982223 CCTGGAAGGCCCCGTAGGCCAGG - Intronic
958892021 3:99794388-99794410 CCTGGAATGCCAGGGAAGCCAGG + Exonic
961365424 3:126396358-126396380 CCTGCAAAGCTCTGGAAACCAGG - Intronic
962350680 3:134653478-134653500 CCTGGCAGGCCCCAGAAGCTAGG - Intronic
965192479 3:165549247-165549269 CCTGGAAAGCCCCTGAATCCAGG + Intergenic
966517020 3:180829738-180829760 CCTGGCAGCCTCAGGAAGCCCGG - Intronic
968318286 3:197742781-197742803 CCAGGAAGGCTCAGGGAGCCAGG - Intronic
968457257 4:706045-706067 CCCGGAAGGCTCCGAACCCCGGG + Intronic
968503680 4:962401-962423 CCTGGAAGGCACCCCACGCCGGG + Intronic
969672346 4:8596745-8596767 ACTGGAAGCCACAGGAAGCCAGG + Intronic
969723528 4:8906346-8906368 CCTGGAAGGTCCTGGAAGCGTGG - Intergenic
971078871 4:23183851-23183873 GCTGGAAGACTCAGCAAGCCAGG + Intergenic
971421174 4:26475390-26475412 CCTAGAAGGGACCGGGAGCCTGG + Intergenic
973822064 4:54670584-54670606 ACTGGAAGGCCTCAGAAGCCAGG + Intronic
975367335 4:73544617-73544639 CCTGGAAAGGGCCTGAAGCCAGG + Intergenic
976398568 4:84583143-84583165 CCGGGCAGGCTCCGGGCGCCAGG - Exonic
980972608 4:139581117-139581139 CCTGGAATGCTCAGGGAGACTGG - Intronic
981131559 4:141162966-141162988 CCTGGAAGGGGGCTGAAGCCAGG + Intronic
985515812 5:344062-344084 CGAGGAAGGCTTCGGGAGCCGGG + Intronic
985656189 5:1132622-1132644 CCTGGAATGGTCCAGAAGGCAGG - Intergenic
990803489 5:59631906-59631928 CCTGGAAGGGGGCTGAAGCCAGG + Intronic
994765998 5:103919308-103919330 TATGGAAGGCTTGGGAAGCCTGG + Intergenic
996213717 5:120842491-120842513 CCTGGAAGATTTGGGAAGCCTGG + Intergenic
997529766 5:134574743-134574765 CCTGGAAAGCTCCAGCAGCCAGG - Intronic
997844639 5:137275682-137275704 TCTGGAAAGCTCCAGAAGCTGGG - Intronic
998611998 5:143699484-143699506 CCTGGAAACCTCCTGAACCCTGG + Intergenic
1000582237 5:163048618-163048640 CCTGGAAGGAGCCTGAAGCCAGG - Intergenic
1001531583 5:172466021-172466043 CCTGGAGGGCTCCAGTAGCGTGG + Intergenic
1002309686 5:178306892-178306914 CCTGGACGGCGCGGCAAGCCTGG - Exonic
1002652799 5:180714489-180714511 CCTGGAAGGCACCAGAAACTAGG - Intergenic
1002818166 6:697882-697904 CCTGGAAGGCTCTACAAGCAAGG - Intergenic
1003330161 6:5122990-5123012 CCTGGAAGGCTCCCAAGCCCTGG - Intronic
1003652599 6:7975189-7975211 CCTGGAAGGCTCCGAAGTTCTGG - Intronic
1004797401 6:19103059-19103081 CCCAGAAGGCTGGGGAAGCCAGG - Intergenic
1006313726 6:33278426-33278448 CCTGGAAGATGCAGGAAGCCTGG + Exonic
1006839255 6:37017828-37017850 CCTGGATTGCTCCAGATGCCAGG - Intronic
1010057725 6:71585499-71585521 ACTGGAAGGATGCTGAAGCCTGG + Intergenic
1012227658 6:96723419-96723441 CCTGGAAGGCTGAGGCAGCTGGG + Intergenic
1012302903 6:97612318-97612340 CCTGGAAGGGGGCTGAAGCCAGG - Intergenic
1015842078 6:137487749-137487771 CCTGGAAAATTGCGGAAGCCGGG - Intergenic
1018176475 6:161182684-161182706 TTTGGAAGGCTCCAGGAGCCAGG - Intronic
1018891727 6:167987681-167987703 CCTCGAAGGCCCCACAAGCCAGG + Intergenic
1019119966 6:169794567-169794589 CCAGGCAGGCTCCCCAAGCCAGG + Intergenic
1019146068 6:169976387-169976409 CCTGGAAGGCTCCGGTCCCTGGG - Intergenic
1019271580 7:152121-152143 CCTGGGAGGCTGAGTAAGCCAGG - Intergenic
1023848933 7:44139860-44139882 CCTGGAAGGCCGAGGCAGCCAGG + Exonic
1025227887 7:57179827-57179849 CCTGGAGGCACCCGGAAGCCCGG - Intergenic
1025301488 7:57822157-57822179 CCGGGACGTCTCCGGATGCCAGG + Intergenic
1027960488 7:84939952-84939974 CCAGGAAGCTTCGGGAAGCCTGG - Intergenic
1031589632 7:123573687-123573709 CCTGGAAGGATACAGAAGCCAGG - Intronic
1032011522 7:128350996-128351018 CCTGGTAGGATCCTGAGGCCGGG + Exonic
1032862448 7:135893481-135893503 CCTGGAAGGCTCTGGGAAACTGG - Intergenic
1034482497 7:151333338-151333360 CCTGGATGGCTCCATAAGCGTGG + Intergenic
1034506728 7:151498166-151498188 CCTTGAAGGTTCCTCAAGCCAGG - Intronic
1035451484 7:158979945-158979967 CCAGGAGGACTCCGGAGGCCGGG - Intergenic
1036827311 8:11987372-11987394 CCTGGAAGTCCCTGGGAGCCAGG - Intergenic
1037754660 8:21703074-21703096 CCTGGAATGGTCCAGAAGCCAGG + Intronic
1037932260 8:22888549-22888571 CCAGGAGGGCTCCAGAAGCCTGG - Intronic
1038426711 8:27468642-27468664 GCTGGAAGGTTCTGGAAGGCTGG - Intronic
1038512712 8:28154926-28154948 TCTGTTAGGCTCTGGAAGCCAGG - Intronic
1039981712 8:42414006-42414028 CCTTGAAGGCTCCTGGAGTCTGG - Intergenic
1040637555 8:49292929-49292951 CCTGGGAGGTTCTGGAAGCCAGG - Intergenic
1044726269 8:95196584-95196606 CCTGGAAGTCCCCGGAATCCAGG - Intergenic
1047626900 8:126665747-126665769 GCTGGAAGCCACCAGAAGCCAGG + Intergenic
1047763138 8:127968893-127968915 CCTGGCAGCCACCAGAAGCCAGG + Intergenic
1048163043 8:132038392-132038414 CCTGGGAGGCTGTGGCAGCCAGG + Intronic
1048931851 8:139321503-139321525 CCTAGTAGGCGCCGGAAGCCAGG - Intergenic
1048964430 8:139605020-139605042 CCTGGAAGGCTCATGAAGACAGG - Intronic
1049334716 8:142077223-142077245 CCTGGAACGCACAGAAAGCCAGG + Intergenic
1049770065 8:144375803-144375825 ACTGGAAGGCTTTGGAAGTCAGG + Intronic
1051544456 9:18258673-18258695 ACTGGAAGACTCCAGGAGCCAGG - Intergenic
1051936307 9:22446983-22447005 GCTGGGAGGCTGGGGAAGCCGGG - Exonic
1052094786 9:24370407-24370429 TCTGGAAGGCCCAGAAAGCCTGG + Intergenic
1052955277 9:34249226-34249248 CCTGGACAGCTCAGGAACCCAGG - Intronic
1054447239 9:65383282-65383304 CCTGAACGTCTCCGGATGCCAGG + Intergenic
1056756502 9:89385213-89385235 CCTGGAAGCCTCCACCAGCCTGG + Intronic
1057266784 9:93622557-93622579 CATGGAAGGGGCCGGGAGCCAGG + Intronic
1060479720 9:124011208-124011230 CCTGGGAGGCCCGGGAAGGCAGG - Intronic
1061489717 9:130938407-130938429 CCTTCGAGGCTCCGGAGGCCCGG - Intronic
1061725675 9:132580765-132580787 CCCCGCAGGCTCGGGAAGCCAGG - Intergenic
1061868122 9:133505909-133505931 TCTGGAAGGCTCAGGCAGCCAGG + Intergenic
1061903323 9:133684057-133684079 GCTGGAGGGCTCTGGAGGCCCGG + Intronic
1062170230 9:135130842-135130864 ACTGGAAGGTGCCAGAAGCCGGG - Intergenic
1062206420 9:135339922-135339944 CCGGGAAGACCCCAGAAGCCGGG - Intergenic
1062381701 9:136290029-136290051 CCTGGAAGCCTCCGGGAGCCTGG - Exonic
1062430645 9:136525564-136525586 CCAGGTGGGCTCCGGAAGGCGGG - Intronic
1062475994 9:136727880-136727902 CCAGGAAGCTTCGGGAAGCCTGG - Intergenic
1186499564 X:10040531-10040553 CCTGGAAGGCTCCTGAGCACAGG + Intronic
1187310159 X:18134075-18134097 CCTGGAATGATCAGGAAGCTTGG - Intergenic
1189057236 X:37710981-37711003 CCTGCCAGGCTCTGGAACCCAGG - Intronic
1191787724 X:64934990-64935012 CCTGGAAAGCGGCTGAAGCCAGG + Intronic
1192142596 X:68658657-68658679 CCTGGGAAGCTCTGGGAGCCAGG + Intronic
1196514208 X:116550420-116550442 CCTGGTAGCATCAGGAAGCCTGG + Intergenic
1197158000 X:123291225-123291247 CCTTGAAGGTGCTGGAAGCCTGG + Intronic
1197698130 X:129572969-129572991 CCTGGAAGGCTACCAAAGCAAGG - Intronic
1199116998 X:144004517-144004539 CTTGCAAGGCTGGGGAAGCCAGG + Intergenic
1199854027 X:151745095-151745117 CCTGGAATGGACCAGAAGCCGGG - Exonic
1200150739 X:153950190-153950212 CAGGGAAGGCCCAGGAAGCCGGG - Intronic
1200206544 X:154320494-154320516 CCTGGAAAGCTGCGGACACCAGG + Intronic