ID: 920682598

View in Genome Browser
Species Human (GRCh38)
Location 1:208084280-208084302
Sequence CCTGGAAGGCTCCGGAAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 237}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920682591_920682598 5 Left 920682591 1:208084252-208084274 CCCTGGGGATGTGGGCTCAGCCT 0: 1
1: 0
2: 5
3: 45
4: 291
Right 920682598 1:208084280-208084302 CCTGGAAGGCTCCGGAAGCCAGG 0: 1
1: 0
2: 1
3: 22
4: 237
920682590_920682598 12 Left 920682590 1:208084245-208084267 CCTGCATCCCTGGGGATGTGGGC 0: 1
1: 0
2: 0
3: 30
4: 316
Right 920682598 1:208084280-208084302 CCTGGAAGGCTCCGGAAGCCAGG 0: 1
1: 0
2: 1
3: 22
4: 237
920682592_920682598 4 Left 920682592 1:208084253-208084275 CCTGGGGATGTGGGCTCAGCCTG 0: 1
1: 0
2: 3
3: 35
4: 366
Right 920682598 1:208084280-208084302 CCTGGAAGGCTCCGGAAGCCAGG 0: 1
1: 0
2: 1
3: 22
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920682598 Original CRISPR CCTGGAAGGCTCCGGAAGCC AGG Intronic