ID: 920688685

View in Genome Browser
Species Human (GRCh38)
Location 1:208129379-208129401
Sequence GCTACAACATAGAACTTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 105}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920688685_920688691 -10 Left 920688685 1:208129379-208129401 CCTACCAAGTTCTATGTTGTAGC 0: 1
1: 0
2: 0
3: 11
4: 105
Right 920688691 1:208129392-208129414 ATGTTGTAGCAGCTGGGGCTGGG 0: 1
1: 0
2: 0
3: 11
4: 171
920688685_920688696 13 Left 920688685 1:208129379-208129401 CCTACCAAGTTCTATGTTGTAGC 0: 1
1: 0
2: 0
3: 11
4: 105
Right 920688696 1:208129415-208129437 GGAATCCCTCTTAGGAAAGGTGG 0: 1
1: 0
2: 1
3: 17
4: 123
920688685_920688698 17 Left 920688685 1:208129379-208129401 CCTACCAAGTTCTATGTTGTAGC 0: 1
1: 0
2: 0
3: 11
4: 105
Right 920688698 1:208129419-208129441 TCCCTCTTAGGAAAGGTGGGTGG 0: 1
1: 0
2: 1
3: 16
4: 193
920688685_920688697 14 Left 920688685 1:208129379-208129401 CCTACCAAGTTCTATGTTGTAGC 0: 1
1: 0
2: 0
3: 11
4: 105
Right 920688697 1:208129416-208129438 GAATCCCTCTTAGGAAAGGTGGG 0: 1
1: 0
2: 1
3: 13
4: 142
920688685_920688694 5 Left 920688685 1:208129379-208129401 CCTACCAAGTTCTATGTTGTAGC 0: 1
1: 0
2: 0
3: 11
4: 105
Right 920688694 1:208129407-208129429 GGGCTGGGGGAATCCCTCTTAGG 0: 1
1: 0
2: 1
3: 17
4: 160
920688685_920688692 -9 Left 920688685 1:208129379-208129401 CCTACCAAGTTCTATGTTGTAGC 0: 1
1: 0
2: 0
3: 11
4: 105
Right 920688692 1:208129393-208129415 TGTTGTAGCAGCTGGGGCTGGGG 0: 1
1: 0
2: 1
3: 41
4: 440
920688685_920688695 10 Left 920688685 1:208129379-208129401 CCTACCAAGTTCTATGTTGTAGC 0: 1
1: 0
2: 0
3: 11
4: 105
Right 920688695 1:208129412-208129434 GGGGGAATCCCTCTTAGGAAAGG 0: 1
1: 0
2: 1
3: 11
4: 85
920688685_920688693 -8 Left 920688685 1:208129379-208129401 CCTACCAAGTTCTATGTTGTAGC 0: 1
1: 0
2: 0
3: 11
4: 105
Right 920688693 1:208129394-208129416 GTTGTAGCAGCTGGGGCTGGGGG 0: 1
1: 0
2: 5
3: 53
4: 542

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920688685 Original CRISPR GCTACAACATAGAACTTGGT AGG (reversed) Intronic
901863810 1:12090853-12090875 ACTTCAACATAGGAATTGGTTGG - Intronic
908790583 1:67777062-67777084 GCTACAACATAAAACATACTGGG - Intronic
911426097 1:97714702-97714724 GCTACTACATTGAAATAGGTTGG - Intronic
912809567 1:112783683-112783705 GCTTCAGCAAAGAGCTTGGTTGG - Intergenic
916002610 1:160631485-160631507 GCTTCAACATAGAAATTTGGGGG - Intronic
920688685 1:208129379-208129401 GCTACAACATAGAACTTGGTAGG - Intronic
1067364273 10:45610585-45610607 GCTTCAACATAGAAATTTGTGGG - Intergenic
1070442149 10:76456879-76456901 CCTGCAACACAGAACTTGTTTGG + Intronic
1072273009 10:93795540-93795562 GCTACAACATAAATTTTGGAGGG + Intronic
1074578852 10:114696917-114696939 GCTGCAACATAGAAATTTGGAGG + Intergenic
1075117665 10:119640477-119640499 ACTTCAACATATAACTTGGCGGG - Intergenic
1080111321 11:28571149-28571171 GCTACAACATTGACCTTTCTAGG + Intergenic
1086613011 11:88779690-88779712 GCTGCAATATAGAACTTAGGAGG - Intronic
1086865266 11:91972369-91972391 GCTACAACATATAAATTTGGTGG + Intergenic
1087715073 11:101598733-101598755 ACTGAAACAAAGAACTTGGTAGG - Intronic
1088170712 11:106993106-106993128 TCTACAATATAGAAGATGGTTGG + Intronic
1093026216 12:14247911-14247933 GCTTCAACATAGAATTTTGAGGG - Intergenic
1099783554 12:87231659-87231681 GCTTCAACATATAAATTGGGGGG + Intergenic
1105609589 13:21956330-21956352 GCTACAAGATAAGATTTGGTGGG + Intergenic
1106841955 13:33693221-33693243 CCTAGAACATAGAACTGGGAAGG - Intergenic
1109456032 13:62591051-62591073 GCTACAACAGATACCTTGGAAGG + Intergenic
1110187974 13:72697264-72697286 ATTACAACATAGAACTTGGCAGG - Intergenic
1110330782 13:74270081-74270103 TGTATAACATAAAACTTGGTTGG + Intergenic
1115808654 14:37080623-37080645 ACTACTACTTAGTACTTGGTAGG + Intronic
1118495893 14:66307876-66307898 GCTTCAACATACAATTTGGTAGG + Intergenic
1120877316 14:89386952-89386974 GCTTCAACATATAAATTGGGGGG + Intronic
1121967143 14:98320900-98320922 GCTGGAATATAGAACTTAGTGGG - Intergenic
1124622511 15:31282249-31282271 GCTTCAACATATAAATTTGTAGG + Intergenic
1125367731 15:38936877-38936899 GCTTCAACATAGAAATTCATGGG - Intergenic
1131630862 15:94175669-94175691 GCTTCAACATAGGAGTTGGCAGG - Intergenic
1135729454 16:24882178-24882200 CCTACCACGTAGAACTTGGTGGG + Intronic
1139656692 16:68391773-68391795 GCTTCAACATATAAATTTGTTGG - Intronic
1144034282 17:11351536-11351558 GCAACAAAATAGAATTTGTTGGG - Intronic
1146317475 17:31819520-31819542 GCTTCAACATATAAATTTGTGGG - Intergenic
1150194790 17:63286048-63286070 ACAACAACATAGAAGTTGGGAGG - Intronic
1150273405 17:63881164-63881186 TCTCCAGCATAGACCTTGGTGGG - Intronic
1151057310 17:71048565-71048587 GCTACCACATAGAACTAAGCAGG - Intergenic
1152041026 17:77903105-77903127 GCAACATCACAGAAGTTGGTGGG - Intergenic
1153090269 18:1334997-1335019 GCTTCAACATAGGAATTTGTGGG + Intergenic
1155026346 18:21944205-21944227 GTTCCAACATAGAATTTGGAGGG - Intergenic
1157940368 18:51921852-51921874 GCAACAACAGAGAATTTAGTGGG - Intergenic
1158428914 18:57365995-57366017 TTTACACCATAGAAATTGGTAGG - Exonic
1158571101 18:58597746-58597768 GCTTCAACATATGACTTGGTGGG - Intronic
1158870061 18:61677695-61677717 GCTACAACCTTGAACTTTGCCGG + Intergenic
1165182702 19:33986420-33986442 GCAACAACTTGGAACTTGGGTGG - Intergenic
925480467 2:4265380-4265402 GCAACATCAGAGAACTGGGTGGG - Intergenic
929914585 2:46123780-46123802 GATACAACATAAAACTTGGCAGG - Intronic
934706976 2:96488406-96488428 CCAACAAAATAGAACTTGGTTGG - Intergenic
938968054 2:136406045-136406067 GCTACAACATAAAAAATGTTTGG + Intergenic
939386175 2:141501791-141501813 GCTACAGCATATTATTTGGTTGG + Intronic
946174617 2:217914866-217914888 TCTGCAAAGTAGAACTTGGTAGG - Intronic
1170636538 20:18110126-18110148 TCTATAAAATAGAACTTGCTGGG + Intergenic
1174887618 20:54352837-54352859 GCTGCAACATGGGAATTGGTGGG + Intergenic
1177717367 21:24856220-24856242 GCTTCAACATATAAATTGGTTGG + Intergenic
1178639221 21:34332812-34332834 GCTTCAACATATAAATTGGGAGG + Intergenic
1179267215 21:39814328-39814350 GCTTCAACATAGAAATTTTTGGG + Intergenic
1182752782 22:32655063-32655085 GCTACAACATATAAATTTGGAGG - Intronic
949428760 3:3949432-3949454 GCTTCAACATAAAAAATGGTAGG + Intronic
951471688 3:23063380-23063402 GCTGCAGCATTTAACTTGGTGGG - Intergenic
952076635 3:29704825-29704847 GTTTCAACATAAAAGTTGGTAGG + Intronic
954123390 3:48514100-48514122 ACTTCAACATATAAATTGGTGGG + Intergenic
954979442 3:54731026-54731048 TCTACCACACAGAACTAGGTTGG + Intronic
955289258 3:57675731-57675753 GTTATAACATAGAGTTTGGTTGG - Intronic
955522076 3:59784772-59784794 GCTCCAACATAGAATCTAGTTGG + Intronic
956108226 3:65844074-65844096 GCTACAACAGTGGAGTTGGTAGG + Intronic
956538536 3:70307507-70307529 GTTATAACATAGAAATTGGGGGG - Intergenic
959230803 3:103648319-103648341 GCTACAATATAGAAATTTGGAGG + Intergenic
963773954 3:149419931-149419953 GCTTCAACGCAGAATTTGGTGGG - Intergenic
971884100 4:32420884-32420906 GCTACAAGATAGATTTGGGTGGG + Intergenic
972442013 4:39103640-39103662 GCTGCAATAAAGAATTTGGTAGG + Intronic
972485305 4:39534690-39534712 GCTACAAGATAAGACTTGGGTGG - Intergenic
974476121 4:62382625-62382647 GCTACAAGATAATATTTGGTTGG + Intergenic
975692083 4:76975252-76975274 CGGACAACATAGAACGTGGTTGG + Intronic
976326187 4:83774372-83774394 GCTAGAATATAGAATTTGTTAGG - Intergenic
980340670 4:131541318-131541340 GCTCCAACATATAACTTGATTGG + Intergenic
980847692 4:138343679-138343701 GCTTCAACCGAGAGCTTGGTAGG + Intergenic
982016505 4:151159657-151159679 TCTAGCACATAGATCTTGGTTGG - Intronic
982540842 4:156668520-156668542 GCTTCAACATAGGAATTTGTAGG + Intergenic
985251990 4:188033546-188033568 GCAACTAAATAGAACTTGATAGG - Intergenic
995714280 5:115066864-115066886 GCTTCAACAAAAAACTTGGAAGG + Intergenic
1004070371 6:12291984-12292006 GCTTCTACAAGGAACTTGGTAGG - Intronic
1007867366 6:44987271-44987293 GCTTCAACATATAAATTGGGCGG + Intronic
1009638319 6:66296046-66296068 TCTTCAACATAGAAATTTGTGGG + Intergenic
1011487727 6:87860297-87860319 GCTTCAACATATAATTTTGTGGG + Intergenic
1012371495 6:98512725-98512747 GCTACCACATGGAACTCTGTTGG - Intergenic
1012635766 6:101538898-101538920 ACTACCACATAAAATTTGGTTGG - Intronic
1014579897 6:123124263-123124285 GCTACAAGATAAGACTTGGGTGG - Intergenic
1014799663 6:125764344-125764366 GCTAAATCTTTGAACTTGGTTGG + Intergenic
1024987748 7:55210181-55210203 GCAATAACATAGCACTTTGTTGG + Exonic
1028484603 7:91344033-91344055 GTTCCCACATAGACCTTGGTGGG - Intergenic
1028755109 7:94425541-94425563 GCTACAACATAGGGGCTGGTAGG + Intronic
1033922283 7:146409032-146409054 CCTACAACTTAGAATATGGTAGG + Intronic
1035521396 8:277485-277507 GCTTCAACATAGAAATTTGCAGG - Intergenic
1036123353 8:6041270-6041292 GCTACAACATATAAATTTGGGGG + Intergenic
1036171487 8:6489666-6489688 GCTACATCAGAGAGATTGGTTGG + Intronic
1036462860 8:8969530-8969552 TCTAAAAGATGGAACTTGGTTGG + Intergenic
1037375296 8:18220766-18220788 GCTACAAGGTAGAAGCTGGTGGG - Intronic
1039630807 8:39109036-39109058 GATTCAACATAGAATTTTGTGGG + Intronic
1040528877 8:48249204-48249226 CCTACAATTTAAAACTTGGTGGG - Intergenic
1041187851 8:55320447-55320469 GCTACTACTCAGAGCTTGGTTGG - Intronic
1041325283 8:56656790-56656812 GTTACAACATAGTATTTGGCAGG - Intergenic
1043491151 8:80750172-80750194 GCTGCAACATGGAACAGGGTTGG + Intronic
1044475112 8:92616817-92616839 GCTACAACATGAAATTTGGGGGG + Intergenic
1044667687 8:94647678-94647700 GCTTCAACATAGGACTTTGGGGG + Intronic
1044888445 8:96805866-96805888 CCTCCACCATAGAACTTGGTAGG + Intronic
1049199460 8:141332979-141333001 GCTAGAAAAGAGAACTGGGTAGG - Intergenic
1050709660 9:8447045-8447067 GCCACAACATAGAGCTTGGATGG + Intronic
1051947113 9:22582185-22582207 GCTAAAACATATAACTTACTTGG - Intergenic
1056621943 9:88221871-88221893 GCTTCAACATAGGAATTTGTGGG - Intergenic
1059153524 9:111969905-111969927 GCTTCAACGTACAAATTGGTCGG + Intergenic
1186588786 X:10905599-10905621 TTTAAAATATAGAACTTGGTTGG - Intergenic
1187011751 X:15286717-15286739 GCTACATAATAGAATTAGGTAGG - Intronic
1187030835 X:15486585-15486607 GCTACAACGTAGAAGTTGCAGGG + Intronic
1192035197 X:67555452-67555474 GCTATATCATTGCACTTGGTGGG + Intronic
1197299654 X:124762267-124762289 GCTACAACATATAAATTTGGGGG + Intronic
1200970753 Y:9150077-9150099 CCTACAATTTAAAACTTGGTGGG - Intergenic
1202140272 Y:21714236-21714258 CCTACAATTTAAAACTTGGTGGG + Intergenic