ID: 920689813

View in Genome Browser
Species Human (GRCh38)
Location 1:208137350-208137372
Sequence AAATCTATACACAGGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 184}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920689813_920689821 16 Left 920689813 1:208137350-208137372 CCATCCACCCTGTGTATAGATTT 0: 1
1: 0
2: 0
3: 17
4: 184
Right 920689821 1:208137389-208137411 AGTGGCCAGCCTGACAAGTTGGG 0: 1
1: 0
2: 0
3: 17
4: 138
920689813_920689818 -2 Left 920689813 1:208137350-208137372 CCATCCACCCTGTGTATAGATTT 0: 1
1: 0
2: 0
3: 17
4: 184
Right 920689818 1:208137371-208137393 TTATACTCCTTTTCTAGGAGTGG 0: 1
1: 0
2: 1
3: 13
4: 234
920689813_920689825 27 Left 920689813 1:208137350-208137372 CCATCCACCCTGTGTATAGATTT 0: 1
1: 0
2: 0
3: 17
4: 184
Right 920689825 1:208137400-208137422 TGACAAGTTGGGTGAAAACTGGG 0: 1
1: 0
2: 1
3: 10
4: 154
920689813_920689824 26 Left 920689813 1:208137350-208137372 CCATCCACCCTGTGTATAGATTT 0: 1
1: 0
2: 0
3: 17
4: 184
Right 920689824 1:208137399-208137421 CTGACAAGTTGGGTGAAAACTGG 0: 1
1: 0
2: 1
3: 15
4: 128
920689813_920689817 -7 Left 920689813 1:208137350-208137372 CCATCCACCCTGTGTATAGATTT 0: 1
1: 0
2: 0
3: 17
4: 184
Right 920689817 1:208137366-208137388 TAGATTTATACTCCTTTTCTAGG 0: 1
1: 0
2: 0
3: 25
4: 264
920689813_920689826 28 Left 920689813 1:208137350-208137372 CCATCCACCCTGTGTATAGATTT 0: 1
1: 0
2: 0
3: 17
4: 184
Right 920689826 1:208137401-208137423 GACAAGTTGGGTGAAAACTGGGG 0: 1
1: 0
2: 1
3: 9
4: 156
920689813_920689820 15 Left 920689813 1:208137350-208137372 CCATCCACCCTGTGTATAGATTT 0: 1
1: 0
2: 0
3: 17
4: 184
Right 920689820 1:208137388-208137410 GAGTGGCCAGCCTGACAAGTTGG 0: 1
1: 0
2: 0
3: 8
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920689813 Original CRISPR AAATCTATACACAGGGTGGA TGG (reversed) Intronic
903010402 1:20325895-20325917 AAATCTAGGCTCAGGGAGGAGGG + Intronic
903149075 1:21392601-21392623 AAACTTATAATCAGGGTGGAAGG + Intergenic
903546612 1:24127918-24127940 AAATCCAGACATAGGCTGGAGGG + Intronic
905976483 1:42178406-42178428 AAATCTATTCACATGGTAAAAGG + Exonic
909964863 1:81896007-81896029 AAATACATACTCAGGCTGGATGG + Intronic
911364943 1:96926845-96926867 AAATGGAAACACTGGGTGGAGGG - Intergenic
912101760 1:106216431-106216453 TCATATATACCCAGGGTGGAGGG + Intergenic
912213472 1:107580531-107580553 AGAGCTATACACTGGGTGGCAGG - Intronic
916063998 1:161121432-161121454 ACACACATACACAGGGTGGATGG - Exonic
916080396 1:161228599-161228621 AAATATATACACAGCGTGGTAGG - Intronic
917488952 1:175481159-175481181 AAGGCTATTCACAGGGTGCAAGG - Intronic
918327327 1:183422377-183422399 AAATTTTTACACATGGTGGAAGG - Intergenic
920689813 1:208137350-208137372 AAATCTATACACAGGGTGGATGG - Intronic
921441737 1:215195592-215195614 AAATCTATATACAGGGAAAACGG - Intronic
921567146 1:216734848-216734870 AAATTTATTTACAGGGTAGAGGG - Intronic
923057119 1:230435254-230435276 TAATTTATACCCAGGATGGAAGG + Intergenic
923819165 1:237416716-237416738 AAATCTATTCACTGGGAGGGAGG + Intronic
923841475 1:237676411-237676433 CATTCTATCCACAGGGTAGAGGG + Intronic
924198294 1:241633300-241633322 AAATGTATAGACATGGTGGTAGG - Exonic
1066299074 10:34080978-34081000 ATATCTAGACACAGTGTGGAAGG - Intergenic
1067279827 10:44862678-44862700 AGATCAATACACAGGGTGCAAGG - Intergenic
1069236794 10:66085934-66085956 GAATCAAAACACAGGGTTGATGG + Intronic
1070236454 10:74632580-74632602 AAAGATATACACAGGGAAGAAGG - Intronic
1072369339 10:94747929-94747951 AATTCTGTACCCAGGGTGAAGGG - Intronic
1073704910 10:105972126-105972148 AAATGTATACACAGTTTCGAAGG - Intergenic
1074673382 10:115821069-115821091 AAATTTATAATCATGGTGGAAGG - Intronic
1076381086 10:130024947-130024969 AATGCTATCCACAGGGTGCATGG + Intergenic
1077232106 11:1462379-1462401 AAATCTATACACGAGGTGGGTGG - Intronic
1078628574 11:12981117-12981139 AAAACAAAACACAGGGTGGGTGG - Intergenic
1080086160 11:28285127-28285149 AAATTTATAATCATGGTGGAAGG - Intronic
1082820246 11:57539850-57539872 AAATCAAAACACAGAGAGGATGG + Intergenic
1086427735 11:86703311-86703333 ATATCTAATCACAGGGTGGTTGG + Intergenic
1088907868 11:114168636-114168658 AAAGCAAGACACAGGGTGGAAGG - Intronic
1089096504 11:115924023-115924045 AACTCTATACAACGGGTAGAAGG - Intergenic
1089312229 11:117566230-117566252 CAATTTATGCAGAGGGTGGAGGG - Intronic
1090086109 11:123652626-123652648 AAATCAATACACAGGGTAATTGG - Intronic
1090783502 11:130028201-130028223 AAGTCTATAAATTGGGTGGATGG - Intergenic
1091055975 11:132419550-132419572 AAATCTCTGCAGATGGTGGAAGG + Exonic
1091281091 11:134382092-134382114 AAATGTTTACACAGTGTGGGAGG - Intronic
1093087934 12:14887205-14887227 AAAGCTCTTCACAGGATGGAGGG - Intronic
1093596726 12:20971537-20971559 AAACTTATACTCATGGTGGAAGG - Intergenic
1095532490 12:43205491-43205513 AAATCTATAATCATGGTAGAGGG + Intergenic
1095910088 12:47417255-47417277 AAATCTATAAACTGAGTGGGTGG - Intergenic
1096189879 12:49609577-49609599 CAATCTCTACACAGGGAGGGTGG - Intronic
1096545626 12:52337973-52337995 AAATAAATAAACAGGGTAGAAGG + Intergenic
1096969320 12:55652615-55652637 ACATCTCTTCACAGGGTGGTAGG - Intergenic
1098194703 12:67987397-67987419 AAATCTACAATCATGGTGGAAGG - Intergenic
1098736731 12:74113870-74113892 TAATCTGTACACTTGGTGGAGGG - Intergenic
1099674476 12:85741449-85741471 AAATCAAAACACAGGAAGGAAGG + Intergenic
1101194772 12:102370906-102370928 AAATTTATAATCATGGTGGAAGG + Intergenic
1101581071 12:106041145-106041167 AAATTTATAATCATGGTGGAAGG + Intergenic
1103375227 12:120450444-120450466 AAATCTACAGTCAGTGTGGATGG - Intronic
1104034641 12:125089857-125089879 GAATGTATAGACAGGATGGATGG - Intronic
1104034691 12:125090159-125090181 GAATGTATAGACAGGATGGATGG - Intronic
1108745964 13:53394230-53394252 AAATCTACGTACAGGGTGCATGG - Intergenic
1111495961 13:89050731-89050753 AAATCAATACACAGGCTTCATGG + Intergenic
1111949114 13:94696050-94696072 AAATCTATAAAAAGGGTGCATGG - Intergenic
1125912648 15:43455277-43455299 AAATCTATACACAGAGAGCAAGG + Intronic
1126621303 15:50642631-50642653 AAATTTATAATCATGGTGGAAGG - Intronic
1131544234 15:93302466-93302488 AAATTTCAACACAGGTTGGAAGG + Intergenic
1132845143 16:1997584-1997606 AAATTTAGAAACAGGGTGGAGGG - Intergenic
1137298914 16:47127067-47127089 GATTTTATATACAGGGTGGAAGG + Intronic
1138688386 16:58746574-58746596 AAATCTTTCCAAAGGGTGGTAGG + Intergenic
1139237525 16:65355651-65355673 GAAGCTAGACACAGGGTAGACGG + Intergenic
1139281023 16:65770545-65770567 AAATCTATAGCCAAGGTGCAGGG - Intergenic
1140465840 16:75181783-75181805 AAACTTATACTCATGGTGGAAGG + Intergenic
1141734468 16:85843097-85843119 GAATCTGGACACAGGGAGGAAGG - Intergenic
1144382364 17:14714754-14714776 AAATGCATACGCAGGGTGCATGG + Intergenic
1144399988 17:14886778-14886800 AAATCTATGCACAGGACGGGTGG + Intergenic
1145245831 17:21268751-21268773 AAACCTATACAGAGGCTGGAGGG - Intergenic
1147864515 17:43543975-43543997 AATTAGATACCCAGGGTGGAGGG + Intronic
1148564940 17:48627073-48627095 AAATCTCTACAAAGAGTGCAAGG - Intronic
1150676982 17:67252665-67252687 AAATTTATACAGAGAGTAGAAGG + Intergenic
1156200629 18:34827568-34827590 AAAACAAAACACAGGGTGAATGG - Intronic
1156781303 18:40853782-40853804 AGATTTTTACACAGGGTTGAGGG - Intergenic
1156873034 18:41970073-41970095 AATTCTACACAGAGAGTGGAAGG - Intronic
1161532967 19:4801118-4801140 ATATCAAGGCACAGGGTGGAGGG - Exonic
1161717780 19:5886526-5886548 AAAGAGATACACAGGGAGGAAGG + Intronic
1162301527 19:9847657-9847679 AAATCTACATACAAGCTGGATGG - Intronic
1163329896 19:16629225-16629247 AAGGCAATAAACAGGGTGGAGGG - Intronic
1164498617 19:28793324-28793346 AAATCTCAAAACAGGGAGGAAGG + Intergenic
925426021 2:3749553-3749575 AAGTCTACTCACAGGGTGAAGGG - Intronic
927617463 2:24613652-24613674 CAATCTCTACACAGGAAGGATGG + Intronic
934056257 2:88253707-88253729 GTGTCTATACACAGGATGGATGG + Intergenic
935073994 2:99722744-99722766 AAATTTATATACAGAATGGAGGG + Intronic
935898136 2:107759821-107759843 ACATCTCCAGACAGGGTGGAAGG + Intergenic
936544749 2:113381279-113381301 AAATTTCTACACATGGTAGAAGG - Intergenic
940484287 2:154276909-154276931 AAATGTACACTCATGGTGGAAGG - Intronic
940968836 2:159871786-159871808 ACATATATACACAGAGAGGAAGG - Intronic
943936684 2:193927050-193927072 ACATGTGTACACTGGGTGGAAGG + Intergenic
944997445 2:205309988-205310010 ATATATATACACAATGTGGAAGG + Intronic
945529355 2:210931277-210931299 AAGCTTATACACAGGGAGGAGGG - Intergenic
946812639 2:223542469-223542491 AAATGTATATACACTGTGGATGG + Intergenic
949059895 2:241950789-241950811 AAACCTGTCCACAGGGTCGATGG - Intergenic
1169415600 20:5413434-5413456 AAATTTATAATCATGGTGGAAGG - Intergenic
1173089591 20:39957775-39957797 ACCTGTAGACACAGGGTGGACGG + Intergenic
1173128076 20:40358626-40358648 AAATGTACACACATGGTGGATGG + Intergenic
1173262531 20:41449520-41449542 AAATCAATTCAGAGGATGGATGG + Intronic
1174146883 20:48458580-48458602 AAAACTAAACACTGGATGGAGGG - Intergenic
1174822326 20:53737448-53737470 AACTCCATACAGAGGGGGGATGG + Intergenic
1174934163 20:54849504-54849526 AAATGTATCCCCAGTGTGGAGGG + Intergenic
1175256617 20:57651911-57651933 ATATTTATACACAGGGAGGTGGG + Exonic
1178614904 21:34124038-34124060 AGATCAATAGAAAGGGTGGAGGG - Intronic
1182984913 22:34707190-34707212 AAAAATATGCCCAGGGTGGATGG + Intergenic
1183038142 22:35155740-35155762 AAATAAATAAACAGGGAGGAGGG + Intergenic
950877120 3:16286166-16286188 AAATGTATTCACATGGTGGTAGG + Intronic
951385258 3:22033858-22033880 AAATCTATAATCAGGATGTAAGG + Intronic
952665242 3:35896139-35896161 AAATCTATACAGAGGGTCTCTGG - Intergenic
953008057 3:38996223-38996245 AAATGTACAGAAAGGGTGGATGG + Intergenic
954633141 3:52057532-52057554 AAATCGACACACAGGGCGGGCGG - Intergenic
957410984 3:79839836-79839858 GCATCTATTCACAGGGTGGCAGG + Intergenic
957591683 3:82207399-82207421 AAACCTATAATCATGGTGGAAGG + Intergenic
957879804 3:86197654-86197676 AAAACTATATACAGTGTGGCTGG + Intergenic
958907009 3:99953284-99953306 AAAACTAGACATAGGGTAGAAGG - Intronic
959999282 3:112713866-112713888 AAATGTATAAACATGGCGGAAGG - Intergenic
960051415 3:113242298-113242320 AAATCTACCCACAGTGTGGGGGG - Intronic
960099466 3:113724913-113724935 AAACCTATAAACATGGTGGAAGG - Intronic
960582533 3:119293423-119293445 AAATCCATATACAGGCTTGAAGG - Intergenic
962911628 3:139856246-139856268 CAATCTATGCACAGGGAGGATGG + Intergenic
963222763 3:142829038-142829060 AAATCCAAACCCAGGGAGGAGGG - Intronic
963337161 3:143988390-143988412 ACATATATACACAGGCTGGGCGG - Intronic
963533779 3:146502830-146502852 AAATTTCTACTCATGGTGGAAGG - Intergenic
966638712 3:182164574-182164596 AAATCTATACCCAGATTGTAAGG + Intergenic
968669560 4:1841749-1841771 GGATGTGTACACAGGGTGGATGG + Exonic
970770063 4:19601650-19601672 AAACTTACAAACAGGGTGGAAGG + Intergenic
971157250 4:24096213-24096235 AAATTTATAATCATGGTGGAAGG - Intergenic
971196282 4:24473327-24473349 AAATCTTCAAACAGGGCGGAAGG - Intergenic
972907123 4:43764183-43764205 AAATCTGTACACAGGTAAGAGGG + Intergenic
975436191 4:74354815-74354837 ACATCTAAACACAGGGATGATGG + Intergenic
980686446 4:136236461-136236483 AAATTTACAAACATGGTGGAAGG - Intergenic
981275305 4:142892563-142892585 AAACCTATAATCATGGTGGAAGG - Intergenic
982338879 4:154272626-154272648 AAACTTATAAACATGGTGGAAGG - Intronic
983886588 4:172987250-172987272 AAACCTATAATCATGGTGGAAGG + Intronic
984722562 4:182989362-182989384 AAATCTATACACATAATGAAAGG + Intergenic
986476541 5:8139656-8139678 AAATCTATACAAACAGTGGAAGG - Intergenic
989347004 5:40440065-40440087 AAAATTATACACATGGTGGCCGG - Intergenic
989767989 5:45109143-45109165 AAAACTAAACACAGGATGGTGGG + Intergenic
992512430 5:77451228-77451250 AATTGTATACACATGCTGGAAGG - Intronic
993129711 5:83879980-83880002 AAACCTATAGTCATGGTGGAAGG - Intergenic
994134444 5:96269038-96269060 AAATTTATAATCATGGTGGAAGG - Intergenic
996913475 5:128682108-128682130 GACTCTATACACAGAGTCGATGG - Intronic
1000674469 5:164104398-164104420 AAATTTATAATCATGGTGGAAGG - Intergenic
1001995296 5:176152681-176152703 ACATCAATACACAGCGTGGTGGG + Intergenic
1003388818 6:5694610-5694632 AAATATATACACCTGGTTGAAGG - Intronic
1004843346 6:19612673-19612695 AAATATATACACTGGGTTGTCGG + Intergenic
1008861359 6:56153364-56153386 AAATCCATAGGCAGGTTGGAGGG - Intronic
1010694652 6:78955849-78955871 AAAGCTCTACATAGAGTGGAGGG - Intronic
1010747179 6:79577632-79577654 AAATCTAAACAAAGGATGTAAGG + Intergenic
1011032071 6:82934205-82934227 AAATTTATAATCATGGTGGAAGG - Intronic
1011233445 6:85188669-85188691 AAAACTATACACATTGTGAAGGG + Intergenic
1012199377 6:96386407-96386429 AAACTTATAAACATGGTGGAAGG - Intergenic
1012296681 6:97533007-97533029 GAATCTTGACACAGTGTGGAAGG + Intergenic
1016446933 6:144143427-144143449 AAAGATATGGACAGGGTGGAGGG + Intergenic
1017350256 6:153432554-153432576 AAACCTATAATCATGGTGGAAGG - Intergenic
1017371762 6:153718521-153718543 AAATCACTAGACAGGATGGATGG - Intergenic
1017379360 6:153810508-153810530 AAACCTATAGTCATGGTGGAAGG - Intergenic
1018478895 6:164170452-164170474 AAAAGTATACAAAGGGTGCAGGG - Intergenic
1018502304 6:164423835-164423857 AAATTTATAATCATGGTGGAAGG - Intergenic
1019151627 6:170010283-170010305 AAATCTATACAAAGTGTGTTGGG - Intergenic
1020339734 7:7096829-7096851 AAATCTATAGACATTGTGGTCGG - Intergenic
1023460166 7:40387386-40387408 AAATCTATGGACAGGGTTCAGGG + Intronic
1023586441 7:41735739-41735761 AAATCTATACATAGAGCAGATGG - Intergenic
1023764868 7:43501257-43501279 GAAGCTATACCCAGGGTGGAAGG - Exonic
1026657125 7:72266547-72266569 AAATCCACACACAGGGAGGAAGG - Intronic
1029099082 7:98113314-98113336 AAACTTATAAACACGGTGGAAGG - Intronic
1029625556 7:101718393-101718415 AAAAGGCTACACAGGGTGGAGGG + Intergenic
1030544746 7:110878316-110878338 AAATCTATTCATAGGTTTGAGGG - Intronic
1033313371 7:140278665-140278687 ATATAGATACACAGGGTAGAAGG - Intergenic
1034056913 7:148044986-148045008 TAAGCTAGACACAGGGTGGCTGG - Intronic
1035102140 7:156408465-156408487 AAATCTACAATCATGGTGGAAGG - Intergenic
1036054327 8:5233782-5233804 AAATTTACAAACATGGTGGAAGG - Intergenic
1037171904 8:15902988-15903010 AAATATACACACACGATGGAAGG + Intergenic
1039930402 8:41981931-41981953 AAAACTTTAAACAGGATGGATGG + Exonic
1042608481 8:70571523-70571545 AAATATATACACAGGGAGCCAGG - Intergenic
1042952850 8:74219555-74219577 TAATATATGCACAGGGTGTAAGG + Intergenic
1043284652 8:78514362-78514384 AAACCTATAATCATGGTGGAAGG - Intergenic
1044418363 8:91962039-91962061 AAAGCCATACACAGGGTGATGGG - Intronic
1044902248 8:96959183-96959205 AAATCTAAACACAGGTGGGCAGG - Intronic
1045034293 8:98165397-98165419 ACTTGTATACACAGGGTGGTAGG + Intergenic
1045150039 8:99395396-99395418 CCATCCTTACACAGGGTGGAAGG + Intronic
1046084578 8:109416386-109416408 AAATCTATACATGCTGTGGATGG + Intronic
1046110522 8:109717906-109717928 AAATCTAAACATAGTCTGGATGG - Intergenic
1046827155 8:118703830-118703852 AAATCCATACGCAGTGTGAAAGG + Intergenic
1048531991 8:135257999-135258021 AAATCCATGCACTGGGTGCATGG + Intergenic
1049756867 8:144314654-144314676 AGATATATACACACAGTGGATGG + Exonic
1050608261 9:7324168-7324190 AACTTTTCACACAGGGTGGAAGG + Intergenic
1051919915 9:22252499-22252521 AAACCTTTACTCATGGTGGAAGG + Intergenic
1052995873 9:34551469-34551491 AGATGTATATACAGGGTGGGGGG - Exonic
1056486493 9:87063361-87063383 AAATCTTGACATGGGGTGGAAGG - Intergenic
1057888841 9:98852764-98852786 AAATCTTTACACAGACTGGGAGG + Intergenic
1057976781 9:99613008-99613030 AAATCTATAGAAACGGTGGAAGG - Intergenic
1061783597 9:133009897-133009919 AAATTTATTCACAGGGGAGATGG - Intergenic
1062069060 9:134545639-134545661 AAATCTCAACCCAGGATGGACGG - Intergenic
1187664919 X:21596241-21596263 CAATCTATACAAGAGGTGGATGG + Intronic
1187691379 X:21871179-21871201 AAATCTATAGACATGGTCTAAGG - Intronic
1188522425 X:31053619-31053641 AAATCTAGACTCAGTGTGAAAGG - Intergenic
1188555241 X:31404417-31404439 AAATGCATCCACATGGTGGATGG - Intronic
1193795448 X:85867328-85867350 AAATGTAAAATCAGGGTGGAAGG - Intronic
1193998379 X:88394668-88394690 AAATTTATAAACAGGGAGGTGGG - Intergenic
1198083045 X:133257114-133257136 AAACCTACACTCATGGTGGAAGG - Intergenic
1199171154 X:144735527-144735549 AAATTTATAATCATGGTGGAAGG + Intergenic
1201511229 Y:14765999-14766021 AAAACTTTGCACAGGTTGGATGG - Intronic