ID: 920694824

View in Genome Browser
Species Human (GRCh38)
Location 1:208174340-208174362
Sequence CTATTCTTGCAGAGGCGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 52}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920694820_920694824 -9 Left 920694820 1:208174326-208174348 CCTGCCTGCTTGTTCTATTCTTG 0: 1
1: 0
2: 2
3: 40
4: 398
Right 920694824 1:208174340-208174362 CTATTCTTGCAGAGGCGCCTGGG 0: 1
1: 0
2: 0
3: 5
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920694824 Original CRISPR CTATTCTTGCAGAGGCGCCT GGG Intronic
902581172 1:17408544-17408566 TTTTTCTTGCAGATGGGCCTAGG - Exonic
905857282 1:41322370-41322392 CTGTTCTTCCAGAGGGGCCTGGG + Intergenic
911353184 1:96781135-96781157 ATATTCATGCAGAGTAGCCTGGG + Intronic
920694824 1:208174340-208174362 CTATTCTTGCAGAGGCGCCTGGG + Intronic
924766788 1:247040089-247040111 CCATTCTTGCAGTGGTACCTAGG + Intronic
1063395531 10:5684444-5684466 CTGTTCTTGCAGCAGCACCTGGG + Intergenic
1069380375 10:67838235-67838257 CTATTATTGCAGTGCTGCCTGGG + Intergenic
1074722967 10:116279170-116279192 TCATTGTTGCAGAGGGGCCTAGG - Intergenic
1076002808 10:126925773-126925795 CTATTTCTGCAGATGCACCTAGG - Intronic
1078467498 11:11560940-11560962 CTTGTCCTGCAGAGGCCCCTTGG + Intronic
1085528816 11:77179723-77179745 CTGTCCTTGCAGATGCGTCTGGG + Exonic
1087246565 11:95845136-95845158 TTATTCTTGCAGGGGCTCTTAGG - Exonic
1090643250 11:128747005-128747027 CTCTTCCTGCAGAGGAGCCCTGG - Intronic
1095234620 12:39781878-39781900 CTGTACTTGCAGAGGTGTCTAGG + Intronic
1096152850 12:49325489-49325511 CTTTCCTTGCAGAGGCTCCAGGG + Exonic
1116370301 14:44121918-44121940 CTTTGCTTGCAGAGGCTCTTTGG + Intergenic
1122069290 14:99195287-99195309 CTTTTCTTCCAGAGGAGCCCTGG - Intronic
1124998385 15:34746148-34746170 CCATCCATGGAGAGGCGCCTGGG + Intergenic
1127792523 15:62410994-62411016 CTATTCTTGTAGAAGAGCCCTGG + Intronic
1134837027 16:17369809-17369831 CTCTTCCTGCACAGCCGCCTTGG + Intronic
1139949169 16:70660886-70660908 CCAGGCTTGCAGAGGCCCCTGGG - Intergenic
1144057465 17:11555728-11555750 CTTTTCTTGCAGAGAAGCCACGG + Exonic
1145396966 17:22504007-22504029 CTATTCCTTCATAGGAGCCTCGG - Intergenic
1148844600 17:50521961-50521983 CTTTTCTTACAGAGGCACATTGG + Exonic
1160535124 18:79587494-79587516 CTATCCCTGCAGTGGCACCTGGG - Intergenic
1161086871 19:2339495-2339517 CTCTTCCTGCTGAGCCGCCTGGG + Intronic
1167930594 19:52860214-52860236 TTTTTCTTACATAGGCGCCTAGG + Intergenic
931166839 2:59757723-59757745 CTTTTCTTGCAGTGGCCCCCAGG - Intergenic
946957436 2:224946746-224946768 GTATTCTAGCAGAGGCTGCTGGG - Intronic
1181165309 22:20980008-20980030 CTCTCCTTGCAGAGGCGACGAGG + Exonic
949132835 3:526051-526073 CTATTCCTTCTGAGGTGCCTCGG - Intergenic
963236550 3:142962747-142962769 CCATACTTGCAGCAGCGCCTGGG - Exonic
964840337 3:160986666-160986688 CATTTCCTGCAGAGGGGCCTGGG + Intronic
968882378 4:3308032-3308054 CGATTCTTGGAGTGGTGCCTTGG + Intronic
969352524 4:6606051-6606073 GTATTCTGGCAGAGGCAGCTGGG - Intronic
974993284 4:69121200-69121222 CTACTCCTGCAGAGAAGCCTAGG - Intronic
976353992 4:84093836-84093858 CTGTTCTTTCAGAGGCAGCTGGG - Intergenic
986336963 5:6762656-6762678 CTATCCTTGCAGGAGCCCCTCGG + Intergenic
988503296 5:31800904-31800926 CTCTCCTTGCAGAGTCTCCTTGG - Intronic
988819456 5:34866880-34866902 CTTTTCTTGCAGAGCCTCCTTGG + Exonic
990008081 5:50965886-50965908 CTGATGTTGCAGAGGAGCCTAGG + Intergenic
993445365 5:88005088-88005110 CTATTCTTGCAAAGGAGACTGGG - Intergenic
998529836 5:142874286-142874308 CTATTCTTCTATAGGCACCTTGG + Intronic
1001965517 5:175907409-175907431 TTATTCCTGCAGAGGGACCTGGG - Intergenic
1002133397 5:177094659-177094681 CCATTCTTGCAGAGGGGGCTGGG - Intronic
1002251433 5:177931785-177931807 TTATTCCTGCAGAGGGACCTGGG + Intergenic
1006402105 6:33823839-33823861 CTATTTGTGCAGAAGCTCCTAGG + Intergenic
1006629254 6:35419594-35419616 CTATTCTTGCATAGACTCCAGGG - Intronic
1014268395 6:119308678-119308700 CTAGTCTTTCAGAGGCTCATTGG - Intronic
1030932118 7:115537262-115537284 CTTTTCTTGGCCAGGCGCCTTGG - Intergenic
1038659905 8:29488097-29488119 CCATTCTTCCAGAGGCTTCTTGG + Intergenic
1040683195 8:49838399-49838421 GTATTCTTGAAGAGCCGGCTTGG + Intergenic
1042369417 8:67974223-67974245 CTTTTCTTTCAGTGGTGCCTTGG + Intronic
1051613623 9:18985641-18985663 CTTTCCTTGCAGAGGCCCTTGGG - Intronic
1056293123 9:85164016-85164038 ATGTTCTTGCAGAGGCTTCTTGG + Intergenic
1060204786 9:121676068-121676090 CTTTTCTGGAAGAGGCGCCTGGG + Intronic
1193679721 X:84502994-84503016 CTATTCTGGCAGAAGCTTCTTGG + Intergenic
1199938903 X:152605098-152605120 CCATTTTTGCAGAGGTGACTGGG + Intergenic