ID: 920694852 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:208174432-208174454 |
| Sequence | GGCTGTGGAGGGAGGGAAGA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 2350 | |||
| Summary | {0: 1, 1: 4, 2: 24, 3: 280, 4: 2041} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 920694843_920694852 | 4 | Left | 920694843 | 1:208174405-208174427 | CCGCGGGTGGGGGTGGGAGGAGG | 0: 1 1: 1 2: 20 3: 140 4: 1066 |
||
| Right | 920694852 | 1:208174432-208174454 | GGCTGTGGAGGGAGGGAAGAAGG | 0: 1 1: 4 2: 24 3: 280 4: 2041 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 920694852 | Original CRISPR | GGCTGTGGAGGGAGGGAAGA AGG | Intronic | ||
| Too many off-targets to display for this crispr | |||||