ID: 920694852

View in Genome Browser
Species Human (GRCh38)
Location 1:208174432-208174454
Sequence GGCTGTGGAGGGAGGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2350
Summary {0: 1, 1: 4, 2: 24, 3: 280, 4: 2041}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920694843_920694852 4 Left 920694843 1:208174405-208174427 CCGCGGGTGGGGGTGGGAGGAGG 0: 1
1: 1
2: 20
3: 140
4: 1066
Right 920694852 1:208174432-208174454 GGCTGTGGAGGGAGGGAAGAAGG 0: 1
1: 4
2: 24
3: 280
4: 2041

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920694852 Original CRISPR GGCTGTGGAGGGAGGGAAGA AGG Intronic
Too many off-targets to display for this crispr