ID: 920697141

View in Genome Browser
Species Human (GRCh38)
Location 1:208189518-208189540
Sequence AAAAAGCGAACCTGGGGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 241}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920697134_920697141 20 Left 920697134 1:208189475-208189497 CCCCTTCTCTTTGAGCTCCTGAG 0: 1
1: 0
2: 5
3: 32
4: 326
Right 920697141 1:208189518-208189540 AAAAAGCGAACCTGGGGCTGAGG 0: 1
1: 0
2: 0
3: 19
4: 241
920697136_920697141 18 Left 920697136 1:208189477-208189499 CCTTCTCTTTGAGCTCCTGAGAA 0: 1
1: 1
2: 3
3: 22
4: 269
Right 920697141 1:208189518-208189540 AAAAAGCGAACCTGGGGCTGAGG 0: 1
1: 0
2: 0
3: 19
4: 241
920697135_920697141 19 Left 920697135 1:208189476-208189498 CCCTTCTCTTTGAGCTCCTGAGA 0: 1
1: 0
2: 3
3: 30
4: 317
Right 920697141 1:208189518-208189540 AAAAAGCGAACCTGGGGCTGAGG 0: 1
1: 0
2: 0
3: 19
4: 241
920697132_920697141 26 Left 920697132 1:208189469-208189491 CCTCCTCCCCTTCTCTTTGAGCT 0: 1
1: 0
2: 4
3: 60
4: 570
Right 920697141 1:208189518-208189540 AAAAAGCGAACCTGGGGCTGAGG 0: 1
1: 0
2: 0
3: 19
4: 241
920697137_920697141 3 Left 920697137 1:208189492-208189514 CCTGAGAAGAGATAAAGAGAAAA 0: 1
1: 1
2: 12
3: 116
4: 1105
Right 920697141 1:208189518-208189540 AAAAAGCGAACCTGGGGCTGAGG 0: 1
1: 0
2: 0
3: 19
4: 241
920697133_920697141 23 Left 920697133 1:208189472-208189494 CCTCCCCTTCTCTTTGAGCTCCT 0: 1
1: 0
2: 4
3: 67
4: 503
Right 920697141 1:208189518-208189540 AAAAAGCGAACCTGGGGCTGAGG 0: 1
1: 0
2: 0
3: 19
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920697141 Original CRISPR AAAAAGCGAACCTGGGGCTG AGG Intronic
902796587 1:18804411-18804433 AAATAGGGAAACTGAGGCTGGGG + Intergenic
903369704 1:22827267-22827289 AAAGAGAGGACCTGGGCCTGGGG - Intronic
904345031 1:29862225-29862247 AAAAAGGGGACATGGGGCAGTGG + Intergenic
904505864 1:30953279-30953301 AGAAAGCGAATCTGGTCCTGGGG - Intronic
905275699 1:36816652-36816674 AAGAAGCTAACCTGAGGTTGGGG - Intronic
905522097 1:38608254-38608276 GGAAAGCGGACCTGGGGCAGAGG + Intergenic
905796517 1:40819227-40819249 GAAAAGCGAGCCTGGGACTCCGG + Intronic
906330193 1:44877878-44877900 AAGAAGAGAACCTAGGGCTGGGG - Intronic
907332699 1:53681619-53681641 AAATAGCCATCCTGGAGCTGTGG - Intronic
907605513 1:55813618-55813640 AAAAAGCTAACATAGGCCTGGGG + Intergenic
907673564 1:56498447-56498469 AAAATGTGGAGCTGGGGCTGGGG - Intronic
907901270 1:58743644-58743666 AAAAAGAGAAGCTGAGTCTGAGG + Intergenic
909895617 1:81065641-81065663 AAAAAGAGAGCCTCGGGGTGGGG + Intergenic
910722181 1:90298575-90298597 AAAAAGAGAAACTGGGGTTTGGG - Intergenic
912410606 1:109478344-109478366 TAAAGGGGAGCCTGGGGCTGTGG + Intronic
912429911 1:109623620-109623642 AAGAGGCCAACCTGGGGCTGTGG + Intronic
912499117 1:110110212-110110234 CAAGAGTGAACATGGGGCTGGGG + Intergenic
916789356 1:168111517-168111539 AGAAAGGGAGCCTGGAGCTGTGG + Intronic
917817676 1:178726063-178726085 AGCAAGCCGACCTGGGGCTGCGG - Intronic
920697141 1:208189518-208189540 AAAAAGCGAACCTGGGGCTGAGG + Intronic
922040028 1:221887376-221887398 AAAAAGGGAATCTGAGGCTGGGG + Intergenic
923542367 1:234897723-234897745 AATCAGAGACCCTGGGGCTGGGG - Intergenic
923939133 1:238800719-238800741 AAAAAGCCAGCCTGGTGCAGTGG + Intergenic
1062981402 10:1725714-1725736 AAAAAACGCATCTGCGGCTGAGG - Intronic
1064380942 10:14840980-14841002 AAGAAAAGAACCTGGGGCCGAGG - Intronic
1064623547 10:17239719-17239741 AGAAAGCCAATATGGGGCTGGGG - Intergenic
1066547620 10:36517697-36517719 AAAAAGCTAACCAGGCGCGGTGG - Intergenic
1069807992 10:71137910-71137932 ATAAAGTGAAGGTGGGGCTGGGG + Intergenic
1070288051 10:75098025-75098047 AACAAGCTCAGCTGGGGCTGAGG + Intronic
1070540634 10:77412823-77412845 AAAAAGCTAACATGGGCCTATGG - Intronic
1070841181 10:79488984-79489006 TAAAAGGGTAACTGGGGCTGTGG - Intergenic
1071320402 10:84449556-84449578 AAAATGCTAACGTAGGGCTGGGG + Intronic
1071601044 10:86958895-86958917 AAAATGCCTCCCTGGGGCTGGGG - Intronic
1071759408 10:88583389-88583411 GAGGAGCAAACCTGGGGCTGCGG + Intronic
1073097299 10:100987608-100987630 AAAGTGGTAACCTGGGGCTGGGG + Intronic
1073286932 10:102395238-102395260 AGAACGCGATTCTGGGGCTGCGG - Intronic
1073667015 10:105545055-105545077 AAAAAGTGATCCTGGGGGTGGGG - Intergenic
1075941660 10:126395293-126395315 AAGAAGCGATTCTGGGTCTGGGG + Intergenic
1076695845 10:132247010-132247032 AATAAGTGAACATGAGGCTGGGG - Intronic
1077040359 11:518467-518489 AAAAAGCTGACCTGGCGCGGTGG - Intergenic
1077718565 11:4605024-4605046 AAACAGCCAACTTGGGGCCGGGG + Intronic
1077865002 11:6214785-6214807 AAAGAGCGGAGCAGGGGCTGGGG + Exonic
1078877336 11:15411691-15411713 ACACAGCTAACCAGGGGCTGAGG - Intergenic
1079619977 11:22542137-22542159 AATAAGAGAAACTGGGCCTGGGG - Intergenic
1079862248 11:25688093-25688115 AAAAAGTTAACCAGGTGCTGTGG + Intergenic
1080072933 11:28111058-28111080 AAAAATGGAAGCTGGGGGTGTGG - Intronic
1080822912 11:35824264-35824286 AGGAAGCTAACCTGGGGCTTCGG + Intergenic
1081660585 11:44885691-44885713 AAAGAGAGAACCTGGGGCTTGGG - Intronic
1083036304 11:59640730-59640752 AAAAAATGAACAGGGGGCTGGGG + Intronic
1083720091 11:64599664-64599686 CAAAGGCGAACCTGGGGCAGGGG - Exonic
1084380204 11:68807035-68807057 AATAAGGGACCCTTGGGCTGAGG + Intronic
1085072051 11:73555716-73555738 AAAAAGAGAAAATGGGGCTAAGG + Intronic
1085918025 11:80914835-80914857 ACAAAAAGAATCTGGGGCTGAGG - Intergenic
1086527447 11:87744756-87744778 ATACAGGGTACCTGGGGCTGTGG + Intergenic
1087426002 11:97986919-97986941 AAAAACCTAACCTGACGCTGTGG - Intergenic
1089723769 11:120454660-120454682 AGAAAGCTTAACTGGGGCTGGGG + Intronic
1090890609 11:130919416-130919438 AAAGAGAGAAGGTGGGGCTGAGG + Intergenic
1091271219 11:134313126-134313148 AGAAACCCAACCAGGGGCTGAGG - Intronic
1091799498 12:3316004-3316026 AAAAAGAGAAAATGTGGCTGAGG + Intergenic
1092791922 12:12077550-12077572 AAAAAGAGAGCCTGGGGCCTAGG + Intronic
1093925581 12:24905098-24905120 CAAAAGAGAGCCTGGGGCTGCGG + Intronic
1094628780 12:32151829-32151851 AAAAAGGGAAACTGGGGGTAGGG - Intronic
1096581648 12:52589494-52589516 ACACAGTGAACCTGGGGCAGAGG + Intronic
1097713331 12:62938402-62938424 AAAAAAGGAACAGGGGGCTGGGG + Intergenic
1098042868 12:66369914-66369936 AACAAGCTAACCTGTGGCTGGGG + Intronic
1100272761 12:93042171-93042193 AAAATGCGAGCCTGGGGCGGTGG - Intergenic
1100961477 12:99967619-99967641 AAAAATAGAACCTGGCGCAGTGG + Intronic
1102263597 12:111461670-111461692 AAAAAAGGAACCAGGGGCCGAGG + Intronic
1104757441 12:131277939-131277961 AAAAGGCAAACCTGGGGCCTCGG - Intergenic
1106188177 13:27426698-27426720 AAAAAGCAAGCCTAGGGCAGAGG - Intronic
1107322114 13:39200999-39201021 AAAAAGGGAACCTGCTGCAGAGG + Intergenic
1107962209 13:45568572-45568594 AAAATGGGAACCAGGGGCAGGGG + Intronic
1108082356 13:46749640-46749662 AAAAAGTAAACATTGGGCTGTGG + Intronic
1110170967 13:72499509-72499531 AAAGAGTGTACCAGGGGCTGTGG - Intergenic
1111131605 13:83984050-83984072 AAAAAACTAGCCGGGGGCTGTGG - Intergenic
1111546758 13:89748100-89748122 AAAAAGGGAACTTGGAGATGGGG + Intergenic
1118640964 14:67792076-67792098 AAAAAGAAAGGCTGGGGCTGGGG + Intronic
1120776154 14:88440067-88440089 AGAAAGGAACCCTGGGGCTGAGG - Intronic
1121201559 14:92122147-92122169 AAGGAGCGAGCCTCGGGCTGGGG + Intronic
1122145302 14:99685094-99685116 ACAAAGCTAAGCTGGGGGTGGGG - Intronic
1125874846 15:43134471-43134493 ACAGAGCTCACCTGGGGCTGTGG - Intronic
1125909948 15:43427508-43427530 AAACAGCAAACCTATGGCTGGGG + Intronic
1126242601 15:46462210-46462232 CAAAACCTAACCTGGGGCTTAGG + Intergenic
1129525680 15:76212626-76212648 AGAAAGTGCACCTAGGGCTGGGG + Intronic
1130884278 15:88080593-88080615 CAAAAGCCACCCTGGGCCTGAGG + Intronic
1133690314 16:8208031-8208053 AAAAAGGGAATCTGAGGCTACGG - Intergenic
1134295253 16:12939875-12939897 AGAAAGCAAATCTGGGACTGGGG + Intronic
1134493076 16:14710698-14710720 AACAAGCAAAACAGGGGCTGGGG - Intronic
1134498457 16:14749822-14749844 AACAAGCAAAACAGGGGCTGGGG - Intronic
1136611707 16:31370477-31370499 AAAAAGGGGACTTGGGCCTGGGG + Intronic
1138505890 16:57478126-57478148 AAAGAGAGAAGCTGAGGCTGAGG - Intronic
1139024297 16:62795656-62795678 CAAAACCAAACCTGGGGGTGTGG - Intergenic
1145230392 17:21169701-21169723 AAATTGACAACCTGGGGCTGAGG - Intronic
1145886303 17:28384654-28384676 CAAAAGCGACCCTGGCGCCGCGG - Intronic
1146724721 17:35147906-35147928 AAAAAGTGAGCATGGGCCTGGGG + Exonic
1147745429 17:42691732-42691754 AGGAAGAGAACCTGGGGTTGGGG - Intronic
1147950149 17:44102958-44102980 ATAAAGGGAACCTGGGCCGGGGG - Intronic
1148074769 17:44928882-44928904 AAAAATTGAGCCTGGGGCAGAGG - Exonic
1148561166 17:48607283-48607305 TAAAAGGGAGCATGGGGCTGGGG + Exonic
1150353970 17:64467681-64467703 AAAAAGCAAACTTGAGGCTGAGG + Intronic
1151434010 17:74082973-74082995 AAAAAGGGAGCTAGGGGCTGGGG + Intergenic
1151490858 17:74431699-74431721 AAAAGGCGAACCTCGGTGTGCGG + Exonic
1152162167 17:78675546-78675568 GAGAAGAGCACCTGGGGCTGCGG - Exonic
1153632401 18:7084095-7084117 AAAAAGCGGCGGTGGGGCTGTGG + Intronic
1154173827 18:12068592-12068614 AAAAAGCCACCCTGCGGCCGGGG - Intergenic
1155674582 18:28414566-28414588 CAAAAGCAAACCTGGGACAGAGG - Intergenic
1156074215 18:33253500-33253522 AAAAAGAGAAACTGGGACTAAGG + Intronic
1156451334 18:37268048-37268070 AAAAAGAGCACCTGGGCCTGAGG + Intronic
1158447941 18:57537347-57537369 AAAGAGCACAGCTGGGGCTGGGG - Intergenic
1159561582 18:70000867-70000889 AAGAAGCAGACCTGGGGCTCTGG + Intergenic
1161024260 19:2028331-2028353 AAAAAGGGAAACTGAGGCAGGGG + Intronic
1161190596 19:2952870-2952892 AAAAAAAAAACCTGAGGCTGAGG + Intergenic
1163631339 19:18419435-18419457 AAAAAGCCACCCTGCGGCCGGGG + Exonic
1164484664 19:28644608-28644630 AAACAGAGAAACTGGGGCAGTGG + Intergenic
1164570319 19:29369979-29370001 AAAAAGGGAACCATGGGGTGGGG - Intergenic
1165175369 19:33925625-33925647 GAAAAGCCCTCCTGGGGCTGGGG + Intergenic
1166009791 19:39933975-39933997 GAAGAGCGTCCCTGGGGCTGAGG + Intronic
1166706240 19:44909426-44909448 AGAAAGAGAAACTGAGGCTGGGG - Intergenic
1168425867 19:56238187-56238209 AAAAAGCAAGCCAGGGGTTGTGG + Intronic
925656742 2:6157445-6157467 AAAAAGGGGTCCTGGTGCTGTGG - Intergenic
926150628 2:10423745-10423767 GCAAAGCAAACCTGGTGCTGTGG - Intronic
927280977 2:21306134-21306156 ATAAAGTGAACCTGGGTGTGAGG + Intergenic
927523000 2:23712385-23712407 AAACAGAAAACCTGGGACTGGGG + Intergenic
927605132 2:24480146-24480168 ATAAAACAAACCTGGGGCGGTGG - Intergenic
929938174 2:46310181-46310203 AGAAAGAGAACATGGGGATGAGG - Intronic
930182876 2:48382520-48382542 AATAGGAGAAACTGGGGCTGTGG + Intergenic
930235676 2:48886868-48886890 AAAGAGCTAATCTGTGGCTGTGG + Intergenic
931470930 2:62537084-62537106 AAAAAGAGAACCAGATGCTGGGG - Intergenic
931728664 2:65133763-65133785 AAAAAACAAAACTGGGGCTTGGG + Intergenic
932881555 2:75506830-75506852 AAAAGTAGAACCTGGGACTGAGG + Intronic
935734587 2:106096730-106096752 AAAAAGCAAAGCTGATGCTGGGG - Exonic
938789515 2:134664355-134664377 AATCAGAGACCCTGGGGCTGGGG - Intronic
942013414 2:171787665-171787687 AAAAAGAGAAGCAGGGGCAGGGG + Intronic
943895205 2:193348842-193348864 AAAAAGCAAAGCTGTTGCTGCGG - Intergenic
945493015 2:210477666-210477688 AAAGAGCAAACCTGGGTGTGGGG - Intronic
945779085 2:214145302-214145324 AAGAAGTAAACCTTGGGCTGTGG - Intronic
946226573 2:218267021-218267043 AAATAGGGTACCTGGTGCTGGGG + Intronic
946355743 2:219183186-219183208 AAAGAGTAAACCTGGGGCAGTGG + Exonic
947150833 2:227113548-227113570 AAATAACGAACATGAGGCTGAGG + Intronic
947724646 2:232389100-232389122 CAAAAGGGAAGCTGAGGCTGTGG + Intergenic
947729873 2:232421722-232421744 CAAAAGGGAAGCTGAGGCTGTGG + Intergenic
948296919 2:236867568-236867590 AAAAAGCGCACCTGGGTCTTAGG - Intergenic
948476263 2:238221832-238221854 AAAAAGGGAACCAGGAGCCGTGG + Intergenic
948485877 2:238280384-238280406 AGAAAGCCAACACGGGGCTGTGG + Intronic
1171402208 20:24881325-24881347 GAAAACAGAACCTGGAGCTGAGG + Intergenic
1171492663 20:25532264-25532286 AAAACGTGAATCTGGGGCTCTGG - Intronic
1171572714 20:26269214-26269236 AAAAAAATAGCCTGGGGCTGAGG - Intergenic
1171805903 20:29680208-29680230 AAAAATGTAGCCTGGGGCTGAGG - Intergenic
1171838159 20:30176226-30176248 AAAAATTTAGCCTGGGGCTGAGG + Intergenic
1172045912 20:32079974-32079996 AAAAACCCAACCAGGTGCTGTGG + Intronic
1172433791 20:34914212-34914234 ACAAAGGGAACCTGGCACTGGGG - Intronic
1179104096 21:38383282-38383304 AAAAAGCTTTACTGGGGCTGGGG - Exonic
1180750241 22:18119519-18119541 AACATGGGAACCTGGGGCCGTGG + Intronic
1181556080 22:23672370-23672392 AAAAAGAAAACCCTGGGCTGGGG + Intergenic
1182541567 22:31045744-31045766 AACAAGAGAACCTTGGGGTGTGG - Intergenic
1182664276 22:31945437-31945459 CAGCAGCAAACCTGGGGCTGTGG - Intronic
1183333332 22:37232858-37232880 AGCCAGTGAACCTGGGGCTGTGG - Exonic
1184017726 22:41798889-41798911 AAAAAGCAAGCTTGGGGCTGTGG + Intronic
1184720334 22:46308916-46308938 AAGAAGCATCCCTGGGGCTGCGG + Exonic
949931839 3:9084693-9084715 ACAAAGTGAATCTGGGTCTGTGG - Intronic
950304083 3:11905038-11905060 AAAAAGCAAACTTTGGGCAGAGG + Intergenic
950694849 3:14690931-14690953 AAACAGCCAGCCAGGGGCTGGGG - Intronic
950801496 3:15555272-15555294 CACAAGCAAAGCTGGGGCTGAGG + Intergenic
953445598 3:42962462-42962484 ATAAAGGGAACTTGGAGCTGTGG - Intronic
954286988 3:49626102-49626124 ACAAAGCCAGGCTGGGGCTGTGG - Intronic
956565756 3:70636393-70636415 AATAAGAGAACTTGGGGCAGAGG - Intergenic
956742011 3:72282514-72282536 AAACAGAGACCCTGGGACTGTGG + Intergenic
956747124 3:72318957-72318979 AACCAGAGAACCTGGGCCTGGGG - Intergenic
957328645 3:78729960-78729982 AAAAAGCAAACCTGGTTTTGTGG - Intronic
959712024 3:109395060-109395082 AAAAAGCAAAGCTGGAACTGAGG + Intergenic
959782600 3:110254524-110254546 AAAAAGTGAGACTGGGGCTGGGG - Intergenic
961094223 3:124140862-124140884 GAAAAGGAAACCTGAGGCTGGGG - Intronic
961406617 3:126684216-126684238 AAAAAGGGAAACTGGGGCCAAGG + Intergenic
961774163 3:129272105-129272127 AGACAGGGAACCTGGGGCAGGGG + Intronic
962271766 3:133982642-133982664 AAGAAGAGACCATGGGGCTGAGG - Intronic
962392963 3:134988721-134988743 AAAAAGAGAATCTGTGGTTGGGG - Intronic
965873376 3:173286937-173286959 AAAAAGAGAACCTGGGTCCCTGG - Intergenic
966148321 3:176837583-176837605 AAAAAGCAAACCTGGGGAATGGG + Intergenic
966536007 3:181034585-181034607 AAAAAGCGCACTTGAAGCTGTGG - Intergenic
967062053 3:185881333-185881355 AAAAAGTGAAACTGAGGATGAGG + Intergenic
967097901 3:186192847-186192869 AAAAAACAAACCTGGTGCGGAGG - Intronic
967427606 3:189345355-189345377 AAAAAGGGAATCTGAGGATGGGG - Intergenic
967976497 3:195037609-195037631 TAAAATCGACTCTGGGGCTGGGG - Intergenic
968423683 4:506432-506454 AGAAAGCAGACCTGGGGCTGAGG + Intronic
968742240 4:2337165-2337187 GAAAAGCGACCGTGGGGCGGTGG + Intronic
969998243 4:11337151-11337173 TAAAAGTGAAACTGGGGATGAGG + Intergenic
971757866 4:30723593-30723615 AAAAAGCGAGACTGTAGCTGTGG - Exonic
972289244 4:37676134-37676156 AAATACCTAACCTAGGGCTGGGG - Intronic
974116635 4:57587001-57587023 AAAAAGCTAGCCAGGTGCTGTGG - Intergenic
975648687 4:76570390-76570412 GAAAATGCAACCTGGGGCTGTGG + Intronic
977365508 4:96063208-96063230 AAACAGTGAACCTGGAGCAGTGG - Intergenic
979786435 4:124720615-124720637 ATAAAGGCAAACTGGGGCTGGGG + Intergenic
984106062 4:175547573-175547595 TAAAAGCGTAACTGAGGCTGAGG + Intergenic
985631955 5:1018440-1018462 ACAAAGCGGACATGGGCCTGGGG + Intronic
987374732 5:17223192-17223214 AAGATTCGAACCTGGTGCTGTGG - Intronic
990480458 5:56205637-56205659 AAACAGTGAATCTTGGGCTGGGG + Intronic
991035470 5:62123667-62123689 AGAAAGCTAACCTGGAACTGGGG + Intergenic
991145403 5:63297160-63297182 AAAAAGAGAAAATGGGGATGAGG + Intergenic
991482088 5:67091437-67091459 AAAAAGAAAAGCTGGAGCTGGGG - Intronic
991959493 5:72030191-72030213 GAAATGTGAGCCTGGGGCTGAGG - Intergenic
992015670 5:72573013-72573035 GAAAGGGGAAGCTGGGGCTGGGG + Intergenic
992898620 5:81270265-81270287 AAACAGCGCAGCTGGGGATGGGG + Intergenic
994114955 5:96051456-96051478 AAGCAGCTAGCCTGGGGCTGGGG + Intergenic
995417424 5:111926198-111926220 TAAAAGCGAAACTGGGGAAGTGG + Intronic
997289816 5:132721441-132721463 AAAAAGTGAAACTGAGGCAGAGG + Intronic
997984846 5:138493638-138493660 ATTCAGCCAACCTGGGGCTGTGG - Intergenic
998126193 5:139623842-139623864 AAAAAACGAACCTGGCGTGGTGG - Intronic
998161017 5:139813092-139813114 AAAGAGCAGACCTGGGGCCGGGG - Intronic
1001170642 5:169416084-169416106 TTACAGAGAACCTGGGGCTGGGG + Intergenic
1001689013 5:173618356-173618378 GAAGAAAGAACCTGGGGCTGAGG - Intergenic
1001944530 5:175767614-175767636 AAAAAGCCAACCTGGCACAGTGG - Intergenic
1002773565 6:309601-309623 AAAGATCTACCCTGGGGCTGAGG - Intronic
1002814668 6:668596-668618 ATTAATCCAACCTGGGGCTGAGG - Intronic
1004850181 6:19691240-19691262 ACAATGCGAACCAGGGGATGGGG - Intergenic
1006021915 6:31122359-31122381 GGAAAGGGAGCCTGGGGCTGTGG - Intronic
1006472543 6:34236854-34236876 AAAGAGCGACCCAGGGGCAGGGG - Exonic
1007065661 6:38987980-38988002 AGAAGGCAAGCCTGGGGCTGAGG - Intronic
1007729080 6:43934960-43934982 AAAAACCCACCCTGAGGCTGTGG + Intergenic
1007852628 6:44819873-44819895 AAAATGCTAACCTGGAGCTGTGG + Intronic
1014601593 6:123419524-123419546 AAAAAATTAACCTGGGGCTGTGG - Intronic
1014676217 6:124369717-124369739 CAAAAGCACACCAGGGGCTGGGG - Intronic
1015510492 6:134033631-134033653 ACAGAGGGCACCTGGGGCTGCGG + Intronic
1018747612 6:166774630-166774652 AAACAGGGAAATTGGGGCTGAGG - Intronic
1019438141 7:1032251-1032273 TGAAATGGAACCTGGGGCTGAGG + Intronic
1019916115 7:4133786-4133808 CGAGAGCTAACCTGGGGCTGGGG - Intronic
1022577729 7:31514482-31514504 AAAAAGCTAATCTGGAGTTGTGG + Intronic
1022639132 7:32164887-32164909 ATAAATTGAACCTGGGGCTAAGG - Intronic
1023290015 7:38658930-38658952 AAAAAGCTGACCTGGGCTTGTGG + Intergenic
1024446370 7:49484224-49484246 AAAATGCAAATATGGGGCTGAGG + Intergenic
1025733242 7:64124882-64124904 AAAAAGTAAACATGGGGCAGAGG + Intronic
1027249727 7:76391585-76391607 AAACAGCCGGCCTGGGGCTGGGG - Intronic
1029502916 7:100944929-100944951 AAAAAAGGAAACTAGGGCTGGGG - Intergenic
1032781461 7:135168105-135168127 AGGAAGGGAACCTCGGGCTGAGG + Intronic
1033174199 7:139109714-139109736 TAAAAGCGATCTTGGGGCTCTGG + Intronic
1034405056 7:150897412-150897434 AGACAGAGACCCTGGGGCTGGGG + Intergenic
1034939868 7:155223561-155223583 GAAAAGCTAAGCTGGGACTGAGG + Intergenic
1038441644 8:27574779-27574801 AAACAGAGGACCTGGGGCTGGGG - Intergenic
1038705141 8:29886428-29886450 TCAAAAAGAACCTGGGGCTGGGG + Intergenic
1039806379 8:41003439-41003461 AAAAAGAGGACATGGGGATGTGG - Intergenic
1041722532 8:60989158-60989180 AAAAAAAGAATCTGGGGCTAGGG - Intergenic
1042397737 8:68311304-68311326 AAAAAGCTAACCTGGGGGCCAGG - Intronic
1042951385 8:74203879-74203901 AAAAGCAGAACCTGGGGCAGGGG + Intergenic
1044244574 8:89927955-89927977 AAAAATCTAACTGGGGGCTGGGG + Intergenic
1046590104 8:116195902-116195924 AAAAAGGGACTCTGTGGCTGAGG - Intergenic
1047961112 8:130012485-130012507 AGAAAGAGCACCAGGGGCTGAGG + Intronic
1049142155 8:140964532-140964554 AAAAAAATTACCTGGGGCTGGGG - Intronic
1050159015 9:2697774-2697796 AAAAAACGAACCTGGGGCCTGGG - Intergenic
1055824331 9:80305750-80305772 AAAAACAGAAACTGGTGCTGGGG + Intergenic
1057911025 9:99020839-99020861 AAAAGGCAAACCTAGGCCTGTGG - Intronic
1058267241 9:102917997-102918019 AAAGAGTGGACTTGGGGCTGGGG + Intergenic
1059764362 9:117369924-117369946 AAAGAGGCAACCTGGGCCTGTGG - Intronic
1059906595 9:118993318-118993340 AAAAAGAGAACCAGGAGCTCTGG + Intergenic
1060521291 9:124295417-124295439 AAGAAGCGGGGCTGGGGCTGGGG + Intronic
1062399613 9:136366659-136366681 AGACAGGGAAACTGGGGCTGGGG - Intronic
1185772517 X:2775659-2775681 AAAAAGGTAACCTTTGGCTGGGG + Intronic
1186158020 X:6746019-6746041 ACAAAGCCCCCCTGGGGCTGTGG + Intergenic
1189705011 X:43750968-43750990 AGAAAGGCAACTTGGGGCTGTGG + Intergenic
1195954522 X:110315488-110315510 AAAAAGAAATCCAGGGGCTGGGG + Intronic
1199725152 X:150572740-150572762 AAAAAGCGATCCAGGCTCTGGGG + Intronic
1202373592 Y:24214191-24214213 AAAAAGCAAATTAGGGGCTGAGG + Intergenic
1202497189 Y:25455929-25455951 AAAAAGCAAATTAGGGGCTGAGG - Intergenic