ID: 920697475

View in Genome Browser
Species Human (GRCh38)
Location 1:208192226-208192248
Sequence AGGGCCCAGAGGTGGGCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 518
Summary {0: 1, 1: 0, 2: 2, 3: 51, 4: 464}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920697475_920697484 18 Left 920697475 1:208192226-208192248 CCTCTGGCCCACCTCTGGGCCCT 0: 1
1: 0
2: 2
3: 51
4: 464
Right 920697484 1:208192267-208192289 GTTGTCTTGTCCTGCTGCCATGG 0: 1
1: 0
2: 3
3: 15
4: 336
920697475_920697481 -4 Left 920697475 1:208192226-208192248 CCTCTGGCCCACCTCTGGGCCCT 0: 1
1: 0
2: 2
3: 51
4: 464
Right 920697481 1:208192245-208192267 CCCTGATCTGAATTCTTCCAGGG 0: 1
1: 0
2: 3
3: 21
4: 196
920697475_920697479 -5 Left 920697475 1:208192226-208192248 CCTCTGGCCCACCTCTGGGCCCT 0: 1
1: 0
2: 2
3: 51
4: 464
Right 920697479 1:208192244-208192266 GCCCTGATCTGAATTCTTCCAGG 0: 1
1: 0
2: 0
3: 10
4: 202
920697475_920697485 25 Left 920697475 1:208192226-208192248 CCTCTGGCCCACCTCTGGGCCCT 0: 1
1: 0
2: 2
3: 51
4: 464
Right 920697485 1:208192274-208192296 TGTCCTGCTGCCATGGACACCGG 0: 1
1: 0
2: 2
3: 20
4: 264
920697475_920697486 26 Left 920697475 1:208192226-208192248 CCTCTGGCCCACCTCTGGGCCCT 0: 1
1: 0
2: 2
3: 51
4: 464
Right 920697486 1:208192275-208192297 GTCCTGCTGCCATGGACACCGGG 0: 1
1: 0
2: 1
3: 20
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920697475 Original CRISPR AGGGCCCAGAGGTGGGCCAG AGG (reversed) Intronic
900003595 1:29430-29452 AGGGCGCAGTGGAGGGCGAGCGG - Intergenic
900023313 1:199946-199968 AGGGCGCAGCGGAGGGCGAGCGG - Intergenic
900310720 1:2032050-2032072 AGGGGCCAGAGGTGGAACACGGG - Intergenic
900511880 1:3064686-3064708 AGGTCCCAGTTGTGGCCCAGTGG - Intergenic
900677198 1:3895080-3895102 AGGGAGGAGAGGTGGGGCAGTGG - Intronic
900872542 1:5314411-5314433 AGGGGAAAGAGGTGAGCCAGAGG - Intergenic
901001665 1:6151920-6151942 TGGGCCCAGAGCTGGCCCTGAGG + Intronic
901067148 1:6499600-6499622 AGGGCCCAGAGTGGGGCCTGTGG + Intronic
901334679 1:8439190-8439212 AGAGAGCAGAGGTGGGCAAGTGG - Intronic
901842551 1:11963322-11963344 AAGGCCCAGAGGTTGGCAACTGG - Intronic
901844229 1:11971798-11971820 AGGGCCCAGGCGTGGGGCACAGG - Intronic
902063363 1:13664023-13664045 AGGGCCAAGAGGTGGCGCTGGGG + Intergenic
902112374 1:14093115-14093137 AGGATGCAGAGGTGGGTCAGAGG - Intergenic
902215530 1:14932191-14932213 AGGCCCCACAGGCGGCCCAGAGG - Intronic
902289894 1:15429020-15429042 AGGGCCAGGAGCTGGGCCTGGGG - Exonic
902360331 1:15938968-15938990 TGGCCCCAGAGGTGGGCAAAGGG + Intronic
902410045 1:16207098-16207120 AGGGCGCAGAGGAGGGGCCGGGG - Exonic
902875230 1:19337025-19337047 AGGGCACACAGGTGGGCCTAGGG - Intergenic
902984361 1:20146574-20146596 AGGGCCCAGTGGTTGCCCACAGG - Intronic
903069341 1:20718858-20718880 AGCGCCCAGAGGTGTGACGGAGG - Intergenic
903286338 1:22279339-22279361 AAGGCCCTGAGGTGGGACTGAGG + Intergenic
903302628 1:22390217-22390239 TCAGCCCAGAGGTGGGGCAGAGG + Intergenic
903341573 1:22658274-22658296 AAGGCCCAGAGGCAGGACAGAGG - Intronic
904033524 1:27547523-27547545 AGGGCCACGGGGTGGGCCAGGGG + Exonic
904424541 1:30414979-30415001 AGGTCAGAGAGGTCGGCCAGGGG - Intergenic
904610644 1:31724444-31724466 AGGTCAGAGAGATGGGCCAGAGG + Intergenic
904976615 1:34461600-34461622 CAGGGCCAGAGGTGGGGCAGGGG + Intergenic
906204917 1:43981544-43981566 TGGACCCAGGGGTGTGCCAGGGG + Intronic
906722635 1:48020141-48020163 AGGGGCAAGAGGTGGGGAAGGGG + Intergenic
907246698 1:53113595-53113617 AGGGCCAAGTGGTGGCCCTGGGG - Intronic
907319185 1:53592193-53592215 AGGGCCCAGCGAGGGGTCAGAGG - Intronic
907493388 1:54825571-54825593 AGGGACCAGTGGTGGCACAGTGG + Intronic
908242104 1:62196236-62196258 AGGACCCAGAGGTGGATCTGAGG - Intronic
912878894 1:113390186-113390208 AGGGCGCAGAGGAGGGGCAGGGG - Intergenic
913137424 1:115906184-115906206 AGGACCCAAAGGTGGGACATGGG + Intergenic
913202276 1:116504595-116504617 AGGGCCCTGAGCTGGGGCAGGGG - Intergenic
915232929 1:154459126-154459148 AAGGGCCAGTGGTGGGCCAATGG - Intronic
915341108 1:155177298-155177320 AGGGCACAGAGGTAGGCCCTGGG + Intronic
915368136 1:155326733-155326755 AGGGGCCTGAGGTGGGCCCAGGG - Exonic
915964155 1:160291975-160291997 AGTGCCCAGAACTGGGACAGCGG + Intronic
919445644 1:197701418-197701440 AGGGCCCATTCGGGGGCCAGGGG + Intronic
919464900 1:197915411-197915433 AGGGCCCTGAGGAGGGGCTGGGG - Intronic
919593903 1:199538062-199538084 AGTGCCCAGAGGTGTGCCTGAGG - Intergenic
919914232 1:202130096-202130118 AGGGACCAGAGGTGGGGCTGGGG - Exonic
919993802 1:202729274-202729296 AGGTCCCAGTGGTGGGACAGTGG - Intronic
920697475 1:208192226-208192248 AGGGCCCAGAGGTGGGCCAGAGG - Intronic
920922687 1:210311396-210311418 CGCCCCCAGAGGTGAGCCAGAGG + Intergenic
922749014 1:228062148-228062170 AGGGCCCAGAGATGGGCATGGGG - Intergenic
923650376 1:235867413-235867435 AGGTCCCAGAGGAAGGCTAGGGG - Intronic
924243026 1:242057878-242057900 AGGGCCCAGCTGTCTGCCAGAGG + Intergenic
924453615 1:244200427-244200449 AGGGGACAGAGCTGGGCCTGGGG + Intergenic
1063284576 10:4671638-4671660 AGCGCCGAAAGGTGAGCCAGAGG + Intergenic
1063365968 10:5491132-5491154 AGGGCTCAGAAGGGGGTCAGGGG - Intergenic
1063372542 10:5531277-5531299 GGGGTCCAGTGCTGGGCCAGAGG - Intergenic
1063457125 10:6191707-6191729 AGTGGACAGCGGTGGGCCAGAGG - Intronic
1064268795 10:13847238-13847260 CGGCCCCAGGGGTGGGACAGGGG + Intronic
1065527578 10:26638385-26638407 AGGGCCCAGAGGTGGGCATTTGG - Intergenic
1065528278 10:26643815-26643837 AGGGCCCAGAAGTGGGCATTTGG - Intergenic
1065558960 10:26943727-26943749 AGGGCCCAGAAGTGGGCATTTGG + Intergenic
1067024968 10:42836880-42836902 AGGGCGCAGAGCTGGGAGAGCGG - Intergenic
1067205339 10:44207735-44207757 AGGAGCCAGAGATGGGGCAGAGG + Intergenic
1067666410 10:48283339-48283361 AGAGCCCAGAGGAGGGGCACAGG - Intergenic
1067990707 10:51208703-51208725 AGGTCCTGGAGCTGGGCCAGTGG + Intronic
1068721997 10:60255894-60255916 GGGGCCCAGAGGTGGTTAAGAGG + Intronic
1069661408 10:70126026-70126048 AGGGCCCAGGGGCTGGCCTGGGG + Intronic
1069717642 10:70531209-70531231 GAGGCCCTGAGGTGGGGCAGTGG + Intronic
1070886659 10:79905553-79905575 GGGGCACAGAGGTGAGTCAGAGG - Intergenic
1071500826 10:86203276-86203298 GGGGCCCTGAGGTGTTCCAGAGG + Intronic
1074764521 10:116690968-116690990 AGGGCCCAGAAATGGGGCATCGG - Intronic
1075833141 10:125428228-125428250 AGAGGCAACAGGTGGGCCAGAGG - Intergenic
1076381473 10:130027187-130027209 AGAGCCCTGAAGTGGGGCAGGGG - Intergenic
1076398744 10:130162798-130162820 AGGCCGCAGGGGTGGGCCTGAGG - Intronic
1076890856 10:133282621-133282643 AGGGTCCGGAGGAGGGCGAGTGG - Intronic
1077844869 11:6013349-6013371 AGGGCCGCGAGCTGGGCAAGGGG - Intergenic
1079350865 11:19690819-19690841 TGGCCCCAGAGAGGGGCCAGTGG + Intronic
1080552260 11:33382838-33382860 AGTCCCCCGAGGAGGGCCAGGGG - Intergenic
1080659111 11:34281465-34281487 AGGGCCCAGGGGAGGCACAGAGG - Intronic
1080745043 11:35101197-35101219 AGGGGCCAGAGGTGCACAAGAGG - Intergenic
1081646843 11:44796015-44796037 AGGGACCACAGGAAGGCCAGAGG - Intronic
1081686477 11:45046775-45046797 AAGGCTCAGAGGTGGGACGGGGG + Intergenic
1081754338 11:45533894-45533916 AGGGTCCAGAGGTGACACAGTGG + Intergenic
1082641027 11:55661845-55661867 AAGGCCCAGAGGAGGGACAAAGG - Intergenic
1083800207 11:65042014-65042036 AAGACCCAGAGATGGGCCCGAGG - Intronic
1083968701 11:66059090-66059112 GGGGCTCAGAGGTGGGTGAGAGG + Intronic
1084231531 11:67757121-67757143 CAGGCCCAGAGGTGGGGCACAGG + Intergenic
1084881939 11:72177746-72177768 AGGGCTCAAAGGTGTGGCAGAGG - Intergenic
1084960366 11:72713203-72713225 AGGTCCCAGAGGAGGGGCCGGGG - Exonic
1084961044 11:72716879-72716901 GGGGCCAAGGGGTGGGCCTGTGG + Intronic
1084971672 11:72775482-72775504 AAGGCCCAGAGGTGGATCACAGG - Intronic
1085049989 11:73375493-73375515 AGGACCTAGTGCTGGGCCAGAGG - Intergenic
1085388033 11:76168316-76168338 AGGGCCTTGAGGGTGGCCAGGGG - Intergenic
1085507759 11:77069867-77069889 AGGGCTCAGAGGTGGGCAGCAGG - Intronic
1086399272 11:86447409-86447431 AGGGACCTGAGGTGGACCAGTGG - Intronic
1086988895 11:93281047-93281069 AGGGCACAGTGATGGCCCAGAGG - Intergenic
1088630590 11:111770562-111770584 TGGGCCTACAGGTGTGCCAGCGG - Intergenic
1088989012 11:114935382-114935404 AGAGCCCAGAGGTGGGCAGTGGG + Intergenic
1089214102 11:116825345-116825367 AGGGGCGCCAGGTGGGCCAGAGG + Intergenic
1089251034 11:117161882-117161904 ACTGCTCAGAGGTGGGCCATGGG + Intronic
1089461253 11:118655703-118655725 GGGCACCAGAGGGGGGCCAGAGG + Intronic
1090815535 11:130291024-130291046 AGGGACCAGAGCTGGGAGAGTGG - Intronic
1091310423 11:134571467-134571489 AGGAAACAAAGGTGGGCCAGAGG - Intergenic
1091359174 11:134961405-134961427 AGTGGCCAGATGTGGCCCAGCGG - Intergenic
1091377012 12:31484-31506 AGGGCGCAGCGGAGGGCGAGCGG - Intergenic
1091550067 12:1530332-1530354 AGGGCCCGGCGCTGGGCGAGTGG - Intronic
1095293044 12:40498259-40498281 AGGGGCAAGAGTTGTGCCAGTGG - Intronic
1095657652 12:44689176-44689198 AAGGCCCAGAGGATGGCCAGGGG - Intronic
1095952121 12:47787264-47787286 AGGCCCCAGAGTTGGATCAGGGG - Intronic
1096215018 12:49793784-49793806 GGGGCCCACAGGCTGGCCAGGGG + Exonic
1096215337 12:49795238-49795260 AGGGCCCTGACTTGGGTCAGTGG + Exonic
1096529036 12:52232007-52232029 AGGGGCTAGAGGTGGGCTAAGGG + Intergenic
1096749702 12:53751211-53751233 AGGGCTCAGAGGAGGGGCGGCGG - Intergenic
1096816290 12:54203856-54203878 AGGGCCCAGAGCAGGGACAATGG + Intergenic
1096857911 12:54498467-54498489 AGTGACAAGAGGTGGGCTAGGGG + Intronic
1097191021 12:57219704-57219726 AGGGGCCGCAGCTGGGCCAGGGG + Intronic
1098208472 12:68137227-68137249 AGGGCCCAGGGGTGTGCGACTGG - Intergenic
1099989928 12:89709930-89709952 AGGGCCCAGGAGCGAGCCAGCGG + Intergenic
1100214686 12:92435271-92435293 ATGGCCCAAAGGAAGGCCAGTGG + Intergenic
1101376085 12:104172513-104172535 AAGGGCCAGAGGAGGCCCAGTGG + Intergenic
1101876325 12:108598752-108598774 AGGGTCCTGAGGTGAGTCAGTGG + Intergenic
1102173502 12:110859864-110859886 AAGGCCCTGAGGTGGGCCAAGGG - Intronic
1103188185 12:118979873-118979895 AGGGCCCAGAGGTGGGGGTCAGG - Intergenic
1103448671 12:121012345-121012367 AGGGCCCTGACGTGGGCCAATGG + Intronic
1103740682 12:123089256-123089278 AGGGGCCCTAGGTGAGCCAGAGG + Intronic
1103885567 12:124197732-124197754 AGGGGCCAGAGGTTGGCCTGGGG + Intronic
1103976527 12:124706207-124706229 GGAGCCCTGAGGTGGGGCAGGGG - Intergenic
1104041707 12:125134930-125134952 AGGGGCCAGAGTTGTGCCAAAGG - Intronic
1104362974 12:128151444-128151466 AAGTCACAGAGGTGGGGCAGAGG - Intergenic
1105771598 13:23617340-23617362 AGGGACCACACCTGGGCCAGGGG + Intronic
1106410284 13:29506524-29506546 ATGACCCAGAGGTGGCCCTGGGG - Intergenic
1106647080 13:31647769-31647791 AGTGCCCTGAGTTGGGCAAGGGG - Intergenic
1106860692 13:33904460-33904482 AAGGCTCTGAGATGGGCCAGTGG - Intronic
1107006618 13:35619579-35619601 AGTTCCAAGAGATGGGCCAGAGG + Intronic
1108747279 13:53408801-53408823 AGGGCCCAGAAGTGGGGTCGTGG + Intergenic
1112373912 13:98821126-98821148 AGGGCCCAGAGGAGCTCCAGAGG - Intronic
1112458011 13:99579274-99579296 AGAGCTCAGAGGTGCGGCAGAGG - Intergenic
1113447172 13:110378430-110378452 ATGGTCCAGAGGTGCGCCTGCGG + Intronic
1113457372 13:110458203-110458225 AGGGCACAGAGGATGCCCAGTGG - Intronic
1113614690 13:111671797-111671819 AGAGCACAGAGCTGGGCCAGTGG + Intronic
1113620159 13:111756711-111756733 AGAGCACAGAGCTGGGCCAGTGG + Intergenic
1113707903 13:112446028-112446050 AGTGGTCAGAGGTGGGGCAGGGG + Intergenic
1114619786 14:24088452-24088474 TGGGCCCAGCTGAGGGCCAGTGG + Intronic
1114763536 14:25344800-25344822 AGAACCCTGAGGTGGGCCAGAGG + Intergenic
1119186987 14:72650150-72650172 AGGACCCAGAGGATGGCCTGGGG + Intronic
1121009565 14:90512148-90512170 GGGGCCCAGGGCTGGGCCTGGGG + Intergenic
1121277724 14:92679228-92679250 TGGGGCCAGAGGTGGGCTGGGGG - Intronic
1121405495 14:93717025-93717047 AGGCCCCAGGAGGGGGCCAGTGG + Intergenic
1121444241 14:93968612-93968634 AGGGCACAGATATAGGCCAGGGG - Intronic
1121797908 14:96750959-96750981 AGGCCCCAGCAGTGGGGCAGAGG - Intergenic
1122042109 14:98996068-98996090 AGGGCCTAGAGTTGGGGGAGGGG + Intergenic
1122378661 14:101286249-101286271 AGGACCCAGAGGTGGGCGGGTGG - Intergenic
1122626566 14:103088107-103088129 AGGGCCCTCGGCTGGGCCAGCGG + Intergenic
1122767550 14:104082438-104082460 AGGGGCCAGAGTGGGGCCTGGGG - Intergenic
1122897755 14:104768895-104768917 AGGGCCCAGAGTTGGGGCCAAGG - Intergenic
1124343309 15:28903792-28903814 AGTGCTCTGTGGTGGGCCAGTGG + Intronic
1124572996 15:30883220-30883242 AGGCCACAGACGTGGCCCAGGGG - Intergenic
1124641789 15:31400532-31400554 TGGTCCCAGAGCTGGGACAGCGG + Intronic
1126304031 15:47234231-47234253 AGAGCCTAGAGGTCTGCCAGAGG - Intronic
1126798784 15:52281885-52281907 AGATCCCAGAGGTGGGTCTGGGG - Intronic
1126910010 15:53407962-53407984 TGGGCTCAGAGGTGGGACTGGGG + Intergenic
1127804123 15:62502913-62502935 AGAGCCCAGAGGTGGGTTGGAGG + Intronic
1128364335 15:66986738-66986760 AGGGCCCAGGGGAGGGTCACGGG - Intergenic
1128497019 15:68204486-68204508 GGGGCCCAGACCTGAGCCAGGGG - Intronic
1128737213 15:70060009-70060031 AGGGCTGAGAGCTGGGACAGAGG - Intronic
1129172656 15:73817529-73817551 AGGGCCCAGAGAGGGGCCTTGGG + Intergenic
1129268462 15:74407377-74407399 AGGGACCAGAGCCAGGCCAGGGG - Intergenic
1129456373 15:75677959-75677981 AGAGCCCAGAGTGGGGCCTGAGG - Intronic
1129524174 15:76203683-76203705 AGGGCCCCCAGGTGTGGCAGAGG + Intronic
1129682882 15:77667926-77667948 AGGGCCCAGGGCTGGGGCTGAGG + Intronic
1130446672 15:84008532-84008554 AGGGACAAGAGGTGGGACAAAGG - Intronic
1130844586 15:87733090-87733112 ATGGCCCAGAGTTAGGGCAGGGG + Intergenic
1131095086 15:89649538-89649560 GAGGCACTGAGGTGGGCCAGTGG - Intronic
1131268935 15:90935058-90935080 AGGACCCAGAGGGAGGCCTGCGG - Intronic
1132027843 15:98418002-98418024 AGTGCAGAGAGGTGGCCCAGAGG + Intergenic
1132449908 15:101961510-101961532 AGGGCGCAGCGGAGGGCGAGCGG + Intergenic
1133771125 16:8867766-8867788 CGAGCCCAGAGGAGGGCCAAAGG + Intronic
1133999083 16:10768692-10768714 AGGCCCCAGAGTTAGGGCAGAGG + Exonic
1135548419 16:23380666-23380688 AGGGCCCAGTGTTGGGGCTGCGG - Exonic
1137688334 16:50402374-50402396 AGGGGCCAGAGAGGTGCCAGGGG - Intergenic
1137754057 16:50887584-50887606 AGATCCCAGAGTTGGGCAAGTGG - Intergenic
1138206774 16:55131061-55131083 ACAGCCCAGGGGTGGGGCAGGGG + Intergenic
1138530209 16:57630715-57630737 AGGGCCCAGAGAAGGGGAAGAGG + Intronic
1138819608 16:60243304-60243326 AGAGCTCAGAGATTGGCCAGGGG + Intergenic
1139357969 16:66378689-66378711 GGAGCCCAGAGGAGGGCCTGTGG - Intronic
1139700109 16:68703062-68703084 TGGGGACAGAGATGGGCCAGCGG + Intronic
1139820616 16:69718286-69718308 AGGGGCCAAAGCTGGGCCAGAGG + Intronic
1140313091 16:73867833-73867855 ACTTCCCAGAGGTGGGCCTGTGG + Intergenic
1140772963 16:78222954-78222976 AAGGCTCAGAGGGGAGCCAGAGG + Intronic
1141091896 16:81136093-81136115 AAGGCCGCGAGGTGGGACAGTGG - Intergenic
1141610067 16:85176282-85176304 ATGGCCTGGAGGTGGGGCAGTGG + Intronic
1141717577 16:85735630-85735652 AGGGCTCGGGGGTGGCCCAGAGG + Intronic
1142050254 16:87953283-87953305 GGGGCTGAGAGGTGGGGCAGGGG - Intronic
1142540475 17:654916-654938 AGCGGCCAGAGGGAGGCCAGAGG - Intronic
1143953743 17:10653404-10653426 AGGGGGAAGAGGTGGGCCGGGGG - Intronic
1143970529 17:10792087-10792109 GGGGCCATGAGGTGGGCCTGGGG + Intergenic
1144344778 17:14339925-14339947 TGTGCCCAGAGGAGGGGCAGAGG + Intronic
1144403904 17:14933985-14934007 AGTGCCCAGAGGTACCCCAGTGG + Intergenic
1145273933 17:21418917-21418939 AGGGCCAGGAGGTGGGCCTGGGG - Exonic
1146272153 17:31491565-31491587 AGGGCCCTGAGGTGGGACGGTGG + Intronic
1147150135 17:38509733-38509755 AGAGCCTAGATTTGGGCCAGCGG + Intronic
1147550341 17:41437447-41437469 TGGGCCCACAGGTGGTGCAGGGG + Exonic
1147952341 17:44114214-44114236 TGAGCACAGAGGTGTGCCAGGGG + Intronic
1147969810 17:44213185-44213207 GGAGCCCAGAGGAGGGCCACGGG - Intronic
1148109661 17:45137333-45137355 AGCACCCAGAGGTGGGCCTGGGG - Intronic
1148602293 17:48903587-48903609 AAGGCCCAGAGGTGGCCCATGGG - Intergenic
1148699078 17:49577207-49577229 AGGCCCCAGAGGTGGGGTAGAGG - Intronic
1148723892 17:49775009-49775031 AGGCAACAGAGGGGGGCCAGAGG - Intronic
1148866460 17:50631343-50631365 AGGGCCATGAGTGGGGCCAGTGG + Intergenic
1149451027 17:56750205-56750227 AGGGCCCAGAGATGAGCAATAGG + Intergenic
1149661933 17:58338527-58338549 AGGGCCCATAACTGGGGCAGGGG - Intergenic
1151535256 17:74735752-74735774 AGCGCCCAGAGTGGGGACAGAGG - Intronic
1151551840 17:74826803-74826825 AGGCCCCAGAGGTGGGGTAGTGG + Intronic
1151990832 17:77572920-77572942 TGGGCACAGAGGCTGGCCAGAGG - Intergenic
1152416587 17:80166675-80166697 GCGGCCCAGAGGTGGGCGTGAGG + Intergenic
1153967211 18:10192697-10192719 AGGTCTCAGGGCTGGGCCAGGGG - Intergenic
1154338043 18:13481705-13481727 AGGGTCCTGAGCTGGGCCTGAGG + Intronic
1154495790 18:14959722-14959744 AGTGGCCAGATGTGGCCCAGCGG + Intergenic
1154495806 18:14959816-14959838 AGTGGCCAGATGTGGCCCAGCGG + Intergenic
1155053191 18:22165621-22165643 ACGGCGCGGAGGTGGGCTAGCGG - Intergenic
1155519599 18:26656103-26656125 GGGGCGCAGAGGTGGGCGGGAGG - Intronic
1156462286 18:37327766-37327788 AGGGCACAGAGGTGGACAAGAGG - Intronic
1157573608 18:48729861-48729883 AGCACCCAGTGGTGGGACAGTGG + Intronic
1158372950 18:56830564-56830586 AGCGCCCAGAGGTGATCTAGAGG - Intronic
1158400428 18:57116762-57116784 AGCACCCACAGGTGAGCCAGAGG - Intergenic
1158546564 18:58402977-58402999 AGTGCCCAGATGTGACCCAGTGG + Intergenic
1158689042 18:59643961-59643983 AGGCTCCAGAGGTGGGGGAGAGG - Intronic
1160087422 18:75789717-75789739 AGGGCCAAGAGGGAGCCCAGAGG + Intergenic
1160424904 18:78773051-78773073 ACGGCCCAGAGGTGGGGGATGGG - Intergenic
1160635348 19:71037-71059 AGGGCGCAGCGGAGGGCGAGCGG - Intergenic
1160963717 19:1736385-1736407 GGGACCCAGAACTGGGCCAGAGG + Intergenic
1161237464 19:3205031-3205053 AGGGCCCTGAAGAGGCCCAGAGG - Intronic
1161273803 19:3404541-3404563 AGGGCCCAGTGGTGCCCCAGAGG + Intronic
1161784325 19:6313906-6313928 AGATGCCAGAGGAGGGCCAGTGG + Intronic
1162064911 19:8119427-8119449 AAGGCCCTGGGGTGGGCCTGAGG - Intronic
1162726241 19:12691154-12691176 CGACCCCAGAGGTGGGCCAAGGG - Exonic
1163468950 19:17486034-17486056 AGGGCCAGGAGATGTGCCAGTGG - Intronic
1163497539 19:17655521-17655543 GGGGCACTGAGGTGGGCCAGGGG - Intronic
1163510806 19:17733933-17733955 AAGGCCCAGAGGTAGGAAAGAGG + Intronic
1163520499 19:17788718-17788740 TGGGCTCAGAGGTGGGCTATAGG + Intergenic
1164156777 19:22602051-22602073 AGGGGGCAAAGGTGGGGCAGGGG - Intergenic
1164392515 19:27837929-27837951 TGGGCCTAGAGGTGGCCTAGAGG - Intergenic
1165058139 19:33191871-33191893 AGGGAGCAGTGGTGGGGCAGAGG - Intronic
1165404012 19:35619066-35619088 AGGGCCTTGTGGAGGGCCAGAGG + Intronic
1165764285 19:38341033-38341055 ATGGCCCAGAGGTAGGAAAGAGG + Intronic
1165936136 19:39390193-39390215 TGGGAGCAGAGGTGGGGCAGCGG - Intronic
1165999791 19:39871131-39871153 AGGGGTCAGAGTTGGGACAGGGG + Intronic
1166326964 19:42056892-42056914 TGGGGGCAGAGATGGGCCAGAGG + Intronic
1166380018 19:42350943-42350965 AGGATCCAGAGGTGGGCAAGGGG - Intronic
1167383738 19:49152437-49152459 AGGGTGCAGGGGTGGGCCAGGGG - Intronic
1167384356 19:49155426-49155448 GGGCCCCAGAGGGGGGTCAGGGG - Intergenic
1167614701 19:50526061-50526083 AGGGCCCAGGGGAGGGACAGGGG - Intronic
1167648069 19:50716513-50716535 AGGGGCCAGAGGAGAGCCTGAGG + Intronic
1168332495 19:55578578-55578600 AGGGGCCGGAGGGGGGCGAGGGG - Exonic
1168700051 19:58432579-58432601 AGGGCCCAGAGCTTACCCAGAGG - Intergenic
1168725344 19:58578191-58578213 GGGGTCCAGGGGTTGGCCAGAGG + Intergenic
925291479 2:2751267-2751289 AGAGCCCAGGGGTGGCCCCGGGG + Intergenic
925592740 2:5526422-5526444 GGGGCCCAGGGTTGGGCCTGGGG - Intergenic
926344237 2:11930885-11930907 AGGGGACAGAGGTGGCCCTGGGG - Intergenic
927151999 2:20201622-20201644 AGGGCCCAGGGTGGGGCCACAGG + Exonic
927690091 2:25202195-25202217 AGGGCCGTGGGGTGGGCTAGGGG - Intergenic
928120570 2:28580993-28581015 AGGGCCCAGAGGGGAGCCTTGGG + Intronic
928133047 2:28667212-28667234 AGGGTCCAGATGTGGGACACAGG - Intergenic
928216586 2:29366493-29366515 GGGGCCCAGAGGTGGTCGAGAGG + Intronic
928232901 2:29515220-29515242 AGGGACCTGAGCTAGGCCAGGGG - Intronic
929963262 2:46512370-46512392 AGGACCCAGAGGTCTACCAGGGG - Exonic
929992158 2:46799571-46799593 GCGGCCCAGGGGCGGGCCAGAGG - Intergenic
931428954 2:62195212-62195234 AGGGCGCATCGGTGGGCCCGGGG + Intergenic
932435403 2:71700211-71700233 AGGAGCCAGAGGTGGACCCGGGG + Intergenic
932732862 2:74232908-74232930 AGGGCCCAGAAGGTGGCCACAGG + Intronic
933562864 2:83910980-83911002 TGGGCCCAGAGGTGGGAAAAAGG - Intergenic
934662428 2:96150254-96150276 GGGGGCCACAGGTGTGCCAGGGG - Intergenic
934973945 2:98787179-98787201 AGGGCTCAGGGGTGGGGCTGGGG + Intergenic
935132592 2:100271688-100271710 GGGACACAGAGGTGGGCCACGGG + Intergenic
935289921 2:101601450-101601472 AGAGAGCAGAGGTGGGCAAGGGG - Intergenic
935854459 2:107259241-107259263 AGGGCCCAGAAGTGGACAACTGG - Intergenic
936977501 2:118234280-118234302 AGGGCCCAGAGAGGGACCTGAGG - Intergenic
937297008 2:120815572-120815594 AGGCTAGAGAGGTGGGCCAGGGG - Intronic
938263862 2:129912667-129912689 AGGGCACAGAGGAGGGGCTGAGG + Intergenic
939630917 2:144524757-144524779 AGGGCTGAAAGGAGGGCCAGAGG - Intergenic
940739105 2:157486526-157486548 AGGGCTCAGAGCTCAGCCAGAGG - Intronic
941333284 2:164207493-164207515 AGGGCCAAGTGGTGGGAGAGAGG - Intergenic
942172257 2:173299827-173299849 GGGGGCCAGAGGTAGTCCAGGGG + Intergenic
942278697 2:174340865-174340887 GGGGCCCCGAGGTGGCCCTGGGG - Intergenic
942812684 2:180017367-180017389 AGAGGCCAAGGGTGGGCCAGAGG - Intergenic
942920705 2:181370174-181370196 TGGGCCCAAATGTGGGCCACAGG + Intergenic
944338796 2:198570002-198570024 AAGGCCCAGGGGTGGCCCAGGGG + Intronic
946413220 2:219526052-219526074 AGGGCTCAGAGCTGTGGCAGGGG - Intronic
947542024 2:230986261-230986283 AGGGGCCAGGGGTGGGGAAGTGG - Intergenic
947754384 2:232550954-232550976 AGGGCGAAGAGCTGGGCCCGGGG + Intronic
948196804 2:236102954-236102976 AGAGCCAAGAGGTGGGGCGGGGG - Intronic
948220569 2:236266134-236266156 GGGCCCCAGAGCTGGGGCAGGGG - Intergenic
948903767 2:240968346-240968368 AGGGCCGGGAGGTGGGAGAGAGG + Intronic
1169260326 20:4133730-4133752 AGGGGCTGGAGGTGGGGCAGGGG + Intronic
1169667590 20:8055257-8055279 AGGGCCAGGAGCTGGGTCAGAGG + Intergenic
1169758756 20:9068820-9068842 AGGGCCCGGCGGTGGGCGGGCGG + Intronic
1171257677 20:23703264-23703286 AGGGGCATGAGGTGGGGCAGAGG - Intergenic
1172127884 20:32636040-32636062 AGGACCCTGAGGGGGGCCTGGGG - Intergenic
1172528904 20:35617406-35617428 AGGGGCCGGGGGTGGGCCTGGGG - Intronic
1172701502 20:36856137-36856159 AGGGCCTGGAGGTGGACCACAGG - Intronic
1172767622 20:37359138-37359160 AGGGCACAGTGGTGGGGCATAGG + Intronic
1173184659 20:40831292-40831314 AGGCCCCAGAGGTGGGTCAGGGG - Intergenic
1174258621 20:49277673-49277695 GGGGCGCTGAGATGGGCCAGGGG + Intronic
1174404126 20:50292776-50292798 AGGGCCCAGAGGGGTGCGTGGGG + Intergenic
1174446954 20:50596890-50596912 TGGGCCCTGTGGTGGGACAGAGG + Intronic
1174838060 20:53876719-53876741 AGGGCCGAGACCTGGGACAGAGG - Intergenic
1175140626 20:56858284-56858306 AGGGACCAGAGGTCGCCCAAAGG - Intergenic
1175140879 20:56859620-56859642 AGGGCCCAGAGAAGGGGCAAAGG - Intergenic
1175440221 20:58985233-58985255 TGGGGCAAGAGCTGGGCCAGGGG - Intronic
1175485026 20:59339615-59339637 TGGGGCCAGAGGATGGCCAGTGG + Intergenic
1175491457 20:59383560-59383582 AGGGGCCTCATGTGGGCCAGGGG - Intergenic
1175734588 20:61376464-61376486 ATGGCACAGAAGTGGGGCAGGGG + Intronic
1175764528 20:61583242-61583264 AGGGCTCTGAGGAGGGACAGAGG + Intronic
1176235154 20:64050445-64050467 AGGGTCCAGGGAGGGGCCAGTGG - Intronic
1176411674 21:6452502-6452524 AGGGCCAGGAGGTTTGCCAGGGG - Intergenic
1178422446 21:32453130-32453152 CAGGCCCAGAGGTGGGGCACAGG - Intronic
1179687168 21:43060824-43060846 AGGGCCAGGAGGTTTGCCAGGGG - Intronic
1180077944 21:45472658-45472680 AGTGCCCCCAGGTCGGCCAGGGG - Intronic
1180174602 21:46081563-46081585 TGGGCCCAGAGCAGGGACAGGGG + Intergenic
1180979716 22:19872813-19872835 AGGACCCAGAGGCAGGCCTGAGG - Intergenic
1181022381 22:20110216-20110238 CGGGCCCACAGGTTGGCCACAGG - Exonic
1181434447 22:22902028-22902050 GGAGCCCAGATGTGGGCTAGAGG + Intergenic
1181467406 22:23117614-23117636 AGGGCCCACTGGGGTGCCAGTGG + Intronic
1181549883 22:23631767-23631789 GGTGGCCAGAGGTGTGCCAGAGG + Intronic
1181694941 22:24588367-24588389 AAGGCCCTGAGGTGGGCAGGAGG - Intronic
1181770232 22:25119877-25119899 AGCTCAGAGAGGTGGGCCAGGGG + Intronic
1181798509 22:25327765-25327787 GGTGGCCAGAGGTGTGCCAGAGG - Intergenic
1182298838 22:29326969-29326991 AGAGGTCAGAGGTGGGGCAGTGG + Intergenic
1183405704 22:37629637-37629659 AGGGCCAGGGGGTGGCCCAGGGG + Intronic
1183424293 22:37730531-37730553 AGAGCCCAGACGTGACCCAGTGG - Intronic
1183519876 22:38290659-38290681 AGGGCACAGAGGTGGACAAAGGG + Intergenic
1183618058 22:38956899-38956921 AGGGCCCAGAGGTGGGAGAAAGG + Intronic
1183627643 22:39014466-39014488 GGAGCCCAGAGGTGGGGCTGGGG - Intronic
1183955081 22:41375022-41375044 AGGGGACAGAGGTGGGCCTCTGG - Intronic
1184187965 22:42877265-42877287 GGGGCCCTGGGGTGGCCCAGGGG + Intronic
1184240121 22:43207445-43207467 AGGGGCCAGGGCTGGGGCAGGGG + Intronic
1184388933 22:44192119-44192141 AGGGCCCATGGGTGGGGCTGGGG + Intronic
1184402524 22:44282222-44282244 AGATCCCAGAGCTGGGGCAGAGG - Intronic
1184688979 22:46108919-46108941 AGGGCCCAGAGGAGGGCAGCAGG - Intronic
1184755826 22:46515191-46515213 AGGTCCCAGAGTGTGGCCAGAGG - Intronic
1184886064 22:47345120-47345142 AGATTCCAGAGGTGGCCCAGCGG + Intergenic
1184898119 22:47424192-47424214 AGTGCACAGAGGAGGGACAGAGG + Intergenic
1185077985 22:48693573-48693595 AAGGCCCAGAGCCGGACCAGGGG - Intronic
1185106091 22:48870705-48870727 AGGGCCAAGGGCTGTGCCAGGGG + Intergenic
1185277070 22:49954393-49954415 ATGGCCCAGAAATGGGCCTGGGG - Intergenic
1185332119 22:50256558-50256580 GGGGCCCTGAGGTGGGGCAGGGG - Intronic
949892775 3:8745658-8745680 AAGCCCCAGAGCAGGGCCAGTGG - Exonic
950127945 3:10522019-10522041 AGTTCACAGAGGTGGGACAGTGG + Intronic
950443301 3:13022317-13022339 AGGGCACAGAGGCTGGCCGGTGG - Intronic
950667014 3:14503751-14503773 AGGGCCCAGCGTTGGGCTCGAGG + Intronic
952845052 3:37681309-37681331 AGGGCCCAGAGGTGGAACCCTGG - Intronic
952968783 3:38637596-38637618 AGGGGCCAGAGCTGGGTGAGGGG - Intronic
953691144 3:45120756-45120778 AAGGCCCTGAGGTGGGAAAGAGG - Intronic
953814625 3:46144409-46144431 TGGGCACAGAGGTGGGTCATGGG - Intergenic
954439988 3:50516569-50516591 CTGGCCCAGGGGTGGGCCTGGGG - Intergenic
956771124 3:72526799-72526821 GAGGCCCAGAGGCAGGCCAGCGG + Intergenic
957048073 3:75391970-75391992 CAGGCCCAGAGGTGGGGCACAGG + Intergenic
959083563 3:101827830-101827852 TGGGCACTGAGGAGGGCCAGAGG - Exonic
959345877 3:105193789-105193811 AGGGCCCAGAGCAGTGACAGAGG + Intergenic
961387316 3:126529957-126529979 AGGGCCCAGTGGAGGGACGGGGG + Intronic
961435298 3:126912632-126912654 AAGGCCCAGAGGTGGCCCCCAGG + Intronic
961652726 3:128425360-128425382 AGGGCCCCGAGGTGTGGCTGTGG + Intergenic
961655242 3:128438292-128438314 TGGGCCCAGGGCTGGGCCAGAGG - Intergenic
961664943 3:128489030-128489052 AGGGCCCCCAGGTGGGTCGGGGG + Intronic
963065549 3:141260920-141260942 AGGGGCCACAGGAGGGCAAGGGG - Intronic
963236859 3:142964077-142964099 AGGGCGGAGAGATGCGCCAGCGG + Intergenic
964646448 3:158963237-158963259 AAGACCCTGAGGTGGCCCAGGGG + Intronic
964808078 3:160633387-160633409 AAGGCCCAGAGGCGGGACACTGG + Intergenic
966850080 3:184159239-184159261 AAGGCCCAGAGGGAGGACAGTGG - Intronic
967035732 3:185647212-185647234 GGGGCCAAGAGGTGGAGCAGGGG + Intronic
967102877 3:186230672-186230694 AGGGCATCGAGATGGGCCAGAGG + Intronic
967553824 3:190831488-190831510 AGGGGCCAGTGGAGGCCCAGTGG - Intergenic
967969137 3:194986343-194986365 CAGTCCCAGAGGTGGGCCTGTGG + Intergenic
968134068 3:196209082-196209104 CGAGCCCAGGGGTGGGACAGAGG + Intronic
968440822 4:623681-623703 AGGGCCCTGGGGTGGGGCTGGGG - Intergenic
968534376 4:1113889-1113911 AGGGCCGGGAGCTGGGCCGGAGG + Intergenic
968555902 4:1246358-1246380 AGGGCCCAGGGGTGGCCAGGAGG - Intronic
968934897 4:3604815-3604837 GAGGACCAGAGGTGGGGCAGCGG + Intergenic
968992532 4:3924427-3924449 CAGGCCCAGAGGTGGGGCACAGG + Intergenic
969057815 4:4413242-4413264 AGGGCCCAGGGGTTGGGCATGGG + Intronic
969416765 4:7065654-7065676 AGGGATCAGAGGTGGGACAATGG + Intronic
969477253 4:7428651-7428673 AAGGCCCTGGGGTGGGCCTGGGG + Intronic
969509915 4:7611964-7611986 AGAGCCCAGAGCTGGGCATGGGG - Intronic
969518506 4:7662066-7662088 CGGGCCCCGAGGTTGGCCAGCGG - Intronic
969675437 4:8611828-8611850 AAGGCCCAGAGGTGGGTCACAGG - Intronic
969694201 4:8725570-8725592 AGGGGCCAGGGGCGGGGCAGAGG + Intergenic
969822822 4:9733195-9733217 CAGGCCCAGAGGTGGGGCACAGG - Intergenic
972557556 4:40195985-40196007 AAGGCCCTGAGGTGGGAAAGAGG - Intronic
975207714 4:71663684-71663706 AGGGCCTAGAAGTGGGCTCGTGG - Intergenic
977724892 4:100284575-100284597 AGGGCCCGAAGGTGAGCCTGAGG - Intergenic
982126597 4:152189143-152189165 AGGGACCAGAGATGGGGGAGAGG - Intergenic
983107540 4:163707958-163707980 TGGGCACAGAGGGGGGCCACAGG + Intronic
984425948 4:179585713-179585735 GGTTCCCAGAGGTGGGACAGTGG - Intergenic
985488123 5:163178-163200 AGGCCCCTGAGGAGGGACAGTGG - Exonic
985529170 5:423870-423892 AGGGCCCAGGAGTGGGGCACAGG + Exonic
985683830 5:1271414-1271436 TGGACCCACAGGTGGCCCAGAGG - Intronic
985801138 5:2005880-2005902 AAGGCACAGAGGTGAGCCAGCGG - Intergenic
986265045 5:6183917-6183939 AGGGCCCTGAGGATGGACAGTGG + Intergenic
987439080 5:17933173-17933195 AGGTCCCGGTGGTGGCCCAGTGG - Intergenic
992402523 5:76424735-76424757 AGAGCCCAGCTCTGGGCCAGTGG - Intronic
992774890 5:80080451-80080473 AGGGCCCAGAGGTGCCACAGGGG - Intronic
994185508 5:96810659-96810681 TAGTCCCAGAGGTGAGCCAGAGG + Intergenic
994774525 5:104026044-104026066 TGGACCCAGAGGAGGGCTAGAGG - Intergenic
997349100 5:133217449-133217471 AAGGCACAGAGGAGGGTCAGGGG - Intronic
998162478 5:139821447-139821469 AGGGGCCAGAGTTGGGCCTGGGG + Intronic
998167256 5:139851395-139851417 TGGGACTAGAGTTGGGCCAGTGG - Intronic
998370224 5:141656016-141656038 AGGGTGCAGAGGTGGGCCAGAGG + Intronic
999828077 5:155293067-155293089 AGAGCTCAGAGCTGGGCCTGGGG + Intergenic
1001187046 5:169584062-169584084 AGGGCGGCGAGGTGGTCCAGCGG - Intronic
1001379295 5:171292963-171292985 AGAGAAGAGAGGTGGGCCAGAGG - Intronic
1001701797 5:173712182-173712204 AGGACACAGAGATGAGCCAGAGG + Intergenic
1001966577 5:175914009-175914031 AAGGCACAGAGGTGTGACAGAGG - Intergenic
1002250370 5:177925195-177925217 AAGGCACAGAGGTGTGACAGAGG + Intergenic
1002530574 5:179842125-179842147 AGGCCCAAGAGTTGGGCTAGGGG - Intronic
1002559564 5:180072067-180072089 AGCGCCCCGAGGAGGGTCAGCGG + Exonic
1002576972 5:180179396-180179418 AGGGCCGATGGATGGGCCAGTGG + Intronic
1002591799 5:180295667-180295689 AGGACCCAGAGATGTGCTAGAGG + Intergenic
1002939162 6:1700762-1700784 AGGTCCCAGTGCTGGGCCCGAGG - Intronic
1004146240 6:13069428-13069450 AGGGCCTGGAAGTGGGGCAGAGG - Intronic
1004168118 6:13274647-13274669 AGAGCCCAGAGCTGAGCTAGGGG - Intronic
1004972071 6:20921650-20921672 AAGCCACAGAGCTGGGCCAGAGG - Intronic
1009193003 6:60652081-60652103 AGGGCCCAGTGGGGGACAAGGGG - Intergenic
1012476699 6:99621515-99621537 AGGGGGCAGAGGTGGGGCTGGGG + Intergenic
1013368782 6:109453577-109453599 TGGGCCTAGAGGCAGGCCAGTGG - Intronic
1013409152 6:109868883-109868905 AGGGCCCAGAAGTGAGCCCAGGG - Intergenic
1014046326 6:116892424-116892446 AGGCCCAAGAAGTGGGCCTGGGG - Intronic
1017931511 6:158959447-158959469 AGGGTCCTGAGGTGGCCCTGGGG + Intergenic
1018016060 6:159713354-159713376 AGGTCCCAGTGATAGGCCAGGGG - Intronic
1019007128 6:168808415-168808437 AGGGCCTCGAGGTCAGCCAGGGG + Intergenic
1019111812 6:169723671-169723693 GGGGCCCCGAGGTGAGCCCGCGG - Intronic
1019406617 7:887435-887457 AGAGCCCTGAAGTGGTCCAGTGG + Exonic
1019492306 7:1321228-1321250 AGGGACTAGAGCTGGGCCTGGGG + Intergenic
1020098503 7:5381379-5381401 GTGGCCCAGAGGTGGGGAAGGGG - Intronic
1020315183 7:6900783-6900805 CAGGCCCAGAGGTGGGGCACAGG + Intergenic
1021918106 7:25455691-25455713 AGGGGGCAGAGGTGGGCAGGAGG - Intergenic
1022225472 7:28358317-28358339 GGGGTCCACAGGTGGGACAGTGG - Intronic
1022425768 7:30267389-30267411 AGGGCCCAGGGTAAGGCCAGGGG + Intergenic
1022488962 7:30801927-30801949 AGGGCCCAGGTGTGGTCCAAGGG - Intronic
1022592690 7:31680840-31680862 AGGGCAAAGAGGTGGGACAAAGG + Intergenic
1023834055 7:44058270-44058292 AGCCCCCAGAGGTGAGCCAGAGG + Exonic
1024604980 7:51015603-51015625 GGGGCCCAGAGGTGGGCCTCGGG - Intergenic
1025177949 7:56811370-56811392 AGAGGCCAGAGCTGGGCCTGGGG + Intergenic
1025181943 7:56827793-56827815 AGAGGCCAGAGCTGGGCCTGGGG + Intergenic
1025689977 7:63749202-63749224 AGAGGCCAGAGCTGGGCCTGGGG - Intergenic
1025777107 7:64569453-64569475 AGGGCGGAGAGGAGGGCCAGGGG + Intergenic
1026015312 7:66667135-66667157 AGGGCCCAGAGAGGGTCCAAGGG + Intronic
1026123527 7:67558884-67558906 AGTGCCCAGAAATGGGCCAGAGG - Intergenic
1026433379 7:70370333-70370355 AGGGCTGAGAGCTGGGGCAGTGG - Intronic
1026805719 7:73428938-73428960 AAGGCACAGAGGTGGGCACGAGG + Intergenic
1026959319 7:74398570-74398592 AGGGCCCAGCCCTGGGCAAGGGG + Intronic
1028504192 7:91553638-91553660 AGTTACCAGAGGTGGGCCACAGG + Intergenic
1029416185 7:100444669-100444691 ATGTCCCAGAGGTCGTCCAGAGG - Intergenic
1029694458 7:102203852-102203874 GGGGCCCAGAGGTGAGCTGGTGG - Intronic
1029983009 7:104896621-104896643 AAGGCCCAGAGGTGGAGCAAAGG + Intronic
1031851368 7:126868168-126868190 GGGGCCCAGCTGTGGCCCAGTGG - Intronic
1032086111 7:128884751-128884773 AGGGCACAGTGGTGGGGCTGGGG - Intronic
1032699167 7:134363800-134363822 AGGGCCCAGAAGTGAGGCACTGG - Intergenic
1032750463 7:134834873-134834895 AGGGCCCTGGGAAGGGCCAGTGG - Intronic
1032991820 7:137402659-137402681 AGGGCCCAGAGAGAGGCCATGGG - Intronic
1033099728 7:138460198-138460220 CGGGGCCTGAGGTGGGCCAGGGG + Intergenic
1034243187 7:149624902-149624924 AGGGGCGAGGGGTCGGCCAGGGG - Intergenic
1034467009 7:151235719-151235741 AGGGCCCACAGAGCGGCCAGTGG - Intronic
1034942253 7:155238008-155238030 AGGGCCCAGGGCAGGGCCAAGGG + Intergenic
1035390076 7:158497794-158497816 AGGGCCCAGAGGCTGTGCAGGGG - Intronic
1037668906 8:20997615-20997637 AGGGCCCAGAGCTGGGTCCCAGG + Intergenic
1038036349 8:23689902-23689924 AGGGCCCAGAGCAAGACCAGTGG - Intergenic
1038348501 8:26754828-26754850 ATGGAGCAGAGGTGGGGCAGGGG - Intronic
1039922831 8:41905308-41905330 AGGGCCCGGGGGAGGGGCAGTGG - Intergenic
1040384503 8:46905125-46905147 AGGGCCCAGAGGTGTCAGAGGGG - Intergenic
1040482521 8:47839461-47839483 TGGGCCCACAGGAGGCCCAGCGG + Intronic
1042723050 8:71844501-71844523 GGGGCCAAGAGGTGGGGCAGGGG + Intronic
1046357031 8:113100901-113100923 ATGGAGCAGAGGTGGGGCAGAGG + Intronic
1049070050 8:140349249-140349271 AGGGCACAGAGGGGGGCCGATGG + Intronic
1049322238 8:142002690-142002712 AGGGCCCAGAAAAGGGCCTGGGG + Intergenic
1049398094 8:142411252-142411274 AGGCCCCAGAGCTGGGCCGAGGG - Intergenic
1049399746 8:142419648-142419670 AGGGCCCAGATGTGCCCCAGTGG - Intergenic
1049693538 8:143973042-143973064 GCGCCCCAGAGGTGGGGCAGGGG + Intronic
1049816294 8:144604175-144604197 AGCGCCCAGAGGTGGCCGGGAGG + Intronic
1051583881 9:18706634-18706656 AGTGCCCAGAGCTGTCCCAGGGG - Intronic
1052964522 9:34329673-34329695 AGCGACCAGAGGTTTGCCAGAGG - Intronic
1054455279 9:65427163-65427185 GAGGACCAGAGGTGGGGCAGCGG - Intergenic
1055410190 9:76020837-76020859 GTGGCCAAGAGGTGGGCCGGAGG - Intronic
1057185848 9:93057367-93057389 AGGCCTGAGAGGTGGGCTAGGGG + Intergenic
1057266330 9:93620283-93620305 AGGACCCAGATGTGGGGAAGTGG - Intronic
1057305226 9:93908421-93908443 AGGGCCCTGAAGTGGGGGAGAGG + Intergenic
1058058723 9:100473841-100473863 GGGTCCCAGGGGTGGGCCCGAGG + Intronic
1059432532 9:114258684-114258706 AGATCCCAGAGCTGGGCTAGGGG - Intronic
1060103927 9:120862049-120862071 AGGGCCCTAGGGTGGCCCAGAGG + Intronic
1060196796 9:121629182-121629204 AGGGCCCCGAGGTGGGCCCCTGG - Intronic
1060205498 9:121680462-121680484 ATGGCCCTGAGTTTGGCCAGGGG + Intronic
1060431203 9:123552607-123552629 AGGGAGCACAGGTGAGCCAGAGG + Intronic
1060665137 9:125428241-125428263 AGTGCTCAGAGGTGGGGCCGCGG + Intergenic
1060947643 9:127579513-127579535 AGAGCCCAGAGCTGGGCCGCAGG + Intergenic
1061231672 9:129319236-129319258 GGGGGCCAGGGGAGGGCCAGAGG - Intergenic
1061318019 9:129809437-129809459 AGGGCCGAGATGAGGGCCCGTGG + Exonic
1061349648 9:130054163-130054185 GGGGCAAAGAGGTGGTCCAGTGG - Intronic
1062216487 9:135392351-135392373 AGGGGCCAGGAGTGGGCCACAGG + Intergenic
1062279794 9:135746835-135746857 AAGGCCCAGAGGGAGGTCAGAGG + Intronic
1062292948 9:135805550-135805572 AGAGAGCAGCGGTGGGCCAGTGG - Intergenic
1062350625 9:136136973-136136995 AGGGCCCAGAGGTGGAGAGGGGG + Intergenic
1062359094 9:136178976-136178998 AGGGCTCAGGGCTGGGCCACAGG + Intergenic
1062591805 9:137277796-137277818 AGGGCGAGGGGGTGGGCCAGGGG - Exonic
1062601090 9:137318862-137318884 TGAGCCCAAAGCTGGGCCAGGGG - Intronic
1185689387 X:2140689-2140711 AGAGCCCAGTGGGGGCCCAGTGG + Intergenic
1186130795 X:6463304-6463326 AAGGACCAGACGTGGGCGAGTGG + Intergenic
1187859563 X:23667902-23667924 AGGGCCCGGAGGCAGCCCAGGGG - Intronic
1189586508 X:42467610-42467632 AGACCCCAGAGGTGGGCAGGTGG + Intergenic
1190305195 X:49077970-49077992 AGGGGTCAGAAGTGGGCCATGGG - Intronic
1192190736 X:68989867-68989889 AGGAAAAAGAGGTGGGCCAGAGG + Intergenic
1192210190 X:69123066-69123088 AGGGGCCTGAAGTGGGGCAGTGG - Intergenic
1195343360 X:103926036-103926058 AGGGGCTAGAGGTGCCCCAGAGG + Intronic
1195363640 X:104107434-104107456 AGGGGCCAGAGGTGGCCCAAAGG - Intronic
1195365169 X:104117537-104117559 AGGAGCCAGAGGTGCCCCAGAGG - Intronic
1196176470 X:112644208-112644230 AGGGGCCAGAGATTGGCCAAAGG - Intronic
1197262679 X:124334287-124334309 AAGGCCCAGAGGGGCCCCAGAGG + Intronic
1197262728 X:124334473-124334495 AAGGCCCAGAGGGGCCCCAGAGG + Intronic
1197262777 X:124334659-124334681 AAGGCCCAGAGGGGCCCCAGAGG + Intronic
1199717128 X:150514917-150514939 AGGGGCCAGAGCTAGGACAGAGG + Intergenic
1200212142 X:154351462-154351484 GGAACCCAGAGCTGGGCCAGGGG + Intronic
1200215949 X:154368359-154368381 TGGGCCCAGAGGAAGGGCAGAGG + Intronic