ID: 920697720

View in Genome Browser
Species Human (GRCh38)
Location 1:208194264-208194286
Sequence CTGCTGTTAATGAGCTGATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 114}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920697716_920697720 25 Left 920697716 1:208194216-208194238 CCAAGTTCACAGTGATGGGAAAA 0: 1
1: 0
2: 1
3: 30
4: 318
Right 920697720 1:208194264-208194286 CTGCTGTTAATGAGCTGATCTGG 0: 1
1: 0
2: 0
3: 7
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920697720 Original CRISPR CTGCTGTTAATGAGCTGATC TGG Intronic
910219200 1:84873229-84873251 TTGCAGTTAATGAACTGATAGGG - Intronic
911593613 1:99775941-99775963 CAGCTATTAATGAGCAGAGCTGG - Intergenic
914934270 1:151964537-151964559 CTGGTGTTACAGAGCTGGTCTGG + Intergenic
915842793 1:159229683-159229705 CTGCTGTTTGGGAGCTGCTCTGG - Intergenic
916210269 1:162354604-162354626 CTGCTGTTGGTGAGAGGATCAGG + Intronic
920090021 1:203445906-203445928 CAGCTGGTGATGGGCTGATCAGG - Intergenic
920697720 1:208194264-208194286 CTGCTGTTAATGAGCTGATCTGG + Intronic
1066217581 10:33302622-33302644 CTGCTGTTAATGAGGAGGTAGGG + Intronic
1066357393 10:34698213-34698235 CTGCAGATAATGATCTCATCTGG - Intronic
1066475752 10:35746127-35746149 CTGCTGTTAATGAACTCTGCAGG - Intergenic
1067005879 10:42661526-42661548 CTGCTGTTAGTGAGCTACTTTGG + Intergenic
1070431879 10:76348483-76348505 CTGTTTTTAATGAGTTGTTCTGG + Intronic
1073584077 10:104692027-104692049 CAGGTATTCATGAGCTGATCAGG + Intronic
1074460252 10:113630132-113630154 CTGCTGTTAGAGGGCAGATCAGG - Intronic
1074786811 10:116849106-116849128 CTGCTGTTAGTGAGCTCCTCCGG - Intergenic
1075470377 10:122684401-122684423 CTTCTGGAAATGAGCTGACCAGG + Intergenic
1078757550 11:14225085-14225107 CTGCTGTGAGTGAGCAGACCTGG - Intronic
1081156233 11:39695423-39695445 CTGGTTTTAATGACCTGATAAGG - Intergenic
1083183888 11:61006594-61006616 CTGCTGGTGTTGAGCTGGTCAGG - Exonic
1083849549 11:65356862-65356884 CTGCTGAAAATGAGCTGAGGAGG - Exonic
1083875083 11:65518613-65518635 CTGCTTCTATTGAGATGATCAGG + Intergenic
1089628861 11:119770871-119770893 CTGCTGTTTGGGAGCTGACCAGG - Intergenic
1095714150 12:45323395-45323417 CTGCTGTTACTCAGATTATCAGG - Intronic
1097678660 12:62628935-62628957 CTGCTATTTATGAGCACATCTGG + Intergenic
1101293288 12:103394158-103394180 CTGCTGTTTCTGAGATGGTCTGG - Intronic
1101584888 12:106077043-106077065 CTGTTTATAATGAGCTCATCTGG + Intronic
1101965180 12:109277524-109277546 CTGCTGTAAATTAGCTCATTTGG - Intergenic
1102596478 12:113996633-113996655 CATCAGTTAATGAGGTGATCAGG + Intergenic
1104258760 12:127163567-127163589 CTGCTGTTAGTGAGGGGAACAGG + Intergenic
1105575707 13:21649677-21649699 CTGCCGTTAATTAGTTTATCAGG - Intergenic
1108074664 13:46667296-46667318 CTGCTTTTTCTGAGCTCATCAGG + Intronic
1112884835 13:104156937-104156959 CTGCTGTTAATAAGCCAAGCAGG + Intergenic
1116799740 14:49429975-49429997 CCGCTGTTAATGTGCTTTTCAGG - Intergenic
1122310880 14:100793279-100793301 CTTCTGTGCATGAACTGATCAGG - Intergenic
1124993351 15:34697633-34697655 CTACTGTTAATGACCTGAAGAGG - Intergenic
1132306780 15:100820765-100820787 ATGCTGTTGATGAGCTGACTAGG - Intergenic
1137686280 16:50389161-50389183 CAGCTCTTATTGAGCTCATCAGG + Intergenic
1142542549 17:671657-671679 CTGCTGTCCAAGAGCTGACCAGG + Intronic
1144153385 17:12473144-12473166 CTCCAGTTAATGAGCAAATCTGG - Intergenic
1144298179 17:13899195-13899217 CTGCTGTGAAGGAGATGAGCAGG - Intergenic
1145400147 17:22525119-22525141 CTGCTCATAATGCGCCGATCAGG - Intergenic
1149226803 17:54481254-54481276 ATGCTGTTTATGAGCTGTTCGGG - Intergenic
1152464038 17:80455935-80455957 CTGCTGTGAATGCGCTGAAGGGG - Intergenic
1157115108 18:44855096-44855118 CTGCTTTAAATAAGCTGATCAGG - Intronic
1158572426 18:58608367-58608389 GTGATGTTAATGGGCTAATCCGG + Intronic
1159955004 18:74512928-74512950 CCGCTCTCAAAGAGCTGATCAGG - Intronic
1162620057 19:11835646-11835668 CTGCTGATAATGTGCTGCTGAGG + Intergenic
925663423 2:6226487-6226509 CTGCTGTTTCTGAGCTCACCTGG - Intergenic
926842891 2:17103061-17103083 CTAGTGTTCATGATCTGATCAGG - Intergenic
929813823 2:45214598-45214620 CTGCAGTTCATGGGCTGATGAGG + Intergenic
930324903 2:49903161-49903183 GTGCTTTTAATGAGCTGCTAGGG + Intergenic
930722527 2:54651409-54651431 CTGCAGGTATTGACCTGATCTGG + Intronic
932982671 2:76688790-76688812 CTGTTGTTTATGAGCTACTCAGG - Intergenic
936088312 2:109484570-109484592 TTGCTGTTGATTAGCTGATAGGG - Intronic
938089461 2:128421813-128421835 CAGCTTTTGATGAGCTGGTCAGG + Intergenic
938762398 2:134437576-134437598 CTGATGTAAATGATGTGATCTGG + Intronic
939011447 2:136851578-136851600 CAGCTGGAAATTAGCTGATCTGG + Intronic
942525679 2:176850296-176850318 CTGCTGGGAATAATCTGATCTGG + Intergenic
942650288 2:178159416-178159438 GTGCTGTTGATGAGCTGAGATGG + Intergenic
943145351 2:184036976-184036998 CTGGTGTTAATGGTCTGATTGGG + Intergenic
944562817 2:200958455-200958477 TTTCTGTTAATGTGCTTATCTGG - Intronic
944987390 2:205193233-205193255 CTGAAGTTGATGTGCTGATCTGG - Exonic
945227054 2:207542434-207542456 CTGCTTTTCATGTGCTGATTTGG + Intronic
945233522 2:207613328-207613350 CTGTTGTTAAGGAGCTGACTTGG - Exonic
945768285 2:214007558-214007580 CTGCTGTCAATGACTTTATCAGG + Intronic
946272448 2:218605643-218605665 CTGCTGCTACTGCCCTGATCAGG + Intergenic
1169543828 20:6630518-6630540 CTGCTATTAATGAGCTCCTATGG - Intergenic
1171031478 20:21680953-21680975 AGGTTGTTAATGAGCTGGTCAGG + Intergenic
1171036564 20:21717000-21717022 CTTCTGTGTTTGAGCTGATCAGG + Intronic
1172976304 20:38908388-38908410 CTGTAGTTAAGGAGGTGATCGGG + Intronic
1179587642 21:42383741-42383763 CCGCTGCTAATGAGTTGCTCTGG + Intronic
951880999 3:27481767-27481789 CTGCTGTTAATGACGTGGTAGGG - Intronic
952244698 3:31574254-31574276 CTGTTGTTTATGAGCTTATCTGG + Intronic
959393597 3:105806965-105806987 CTACTGTTATTGAGCTGCACAGG + Intronic
960400781 3:117195394-117195416 CTTCTGTTATTGAGCTTTTCTGG - Intergenic
961027434 3:123571400-123571422 CTGCTTTTAAAGGGCTCATCTGG - Intronic
962191531 3:133316073-133316095 CTTCTGGTAATCAGCTGGTCTGG + Intronic
962433968 3:135347467-135347489 CTGCTGTCAGAGAGCTGATGAGG - Intergenic
964496277 3:157294113-157294135 CTGATGTTAAAGAGCTAATTTGG + Intronic
965395601 3:168157412-168157434 CTGTGGATAATGAGCTGATAAGG - Intergenic
967570772 3:191025941-191025963 ATGTTGTTTATGAGCTGATTGGG + Intergenic
973023345 4:45232989-45233011 CTGCTTTAAATCAGCTCATCAGG + Intergenic
974194335 4:58552291-58552313 CTGCTTTTAATGAGGTAATGAGG - Intergenic
978852993 4:113360340-113360362 ATGTTGATCATGAGCTGATCAGG - Intronic
982962211 4:161854182-161854204 CTTCTGGTGATGAGCTGATCGGG + Intronic
985972573 5:3389983-3390005 CTGCTATTAATAATGTGATCTGG + Intergenic
993709553 5:91211170-91211192 CTGCTGTGACTGTGCTGTTCTGG + Intergenic
1003025223 6:2548953-2548975 CTGCTGTTAAACATTTGATCAGG + Intergenic
1004761657 6:18673566-18673588 CTGCTGTAAATGAGATAATATGG + Intergenic
1011973452 6:93259587-93259609 CTGCTGTGAATCAGGTGATGTGG - Intronic
1014242020 6:119028266-119028288 CTGCTGTTAAAGAACAGAACTGG - Intronic
1014764466 6:125390760-125390782 GTGCTGTTAAAGATCTGAACTGG + Intergenic
1023131470 7:37007331-37007353 CTGCTGTTATTGATCTGAACTGG - Intronic
1023224125 7:37951355-37951377 CTCTTGTGAATGAGCTGACCTGG - Exonic
1024422618 7:49186818-49186840 ATGCTGTTCATGAGGTGCTCAGG - Intergenic
1030202199 7:106917170-106917192 CTGCTGTAAATGAGTTAATGAGG - Intergenic
1031071944 7:117171476-117171498 CTGCTGCTAATGAGAAGAGCTGG - Intronic
1032187462 7:129739507-129739529 ATGCTGTTTATGAGCTGAGAAGG - Intronic
1035070501 7:156141297-156141319 CTGCTGGGACTGAGCTGCTCTGG - Intergenic
1035992041 8:4502705-4502727 CTGCTGTTAATATACTGATGAGG - Intronic
1036111655 8:5909830-5909852 CTGCTTTTAAAGGGCTGATAAGG - Intergenic
1037980604 8:23250595-23250617 CTGCTGTGGATGAGGTGATAGGG + Intronic
1040722543 8:50343949-50343971 CTGGTGTTAGTCATCTGATCAGG + Intronic
1042704854 8:71655253-71655275 CTGCTGTTCTTGAGCTGAGAGGG + Intergenic
1045298300 8:100891327-100891349 CAGCTGGTAATGAGCTGGTCTGG - Intergenic
1046651912 8:116844815-116844837 CTGCTTTTAATTAGCTCATAGGG + Intronic
1047128121 8:121985856-121985878 CTGCTCTTAAAGAGCTGGACTGG - Intergenic
1047201246 8:122769738-122769760 CTGCTGTTACTGAGCTGGAGTGG + Intergenic
1047807888 8:128378396-128378418 CTGCTGCTAATGAGTTAAGCTGG + Intergenic
1048309003 8:133303830-133303852 CTGCTGTTTATAAGCTACTCTGG + Intergenic
1049920878 9:363005-363027 CTGCTGTAATTGAGCAGCTCTGG - Intronic
1055346715 9:75347034-75347056 CTGCTGTTATTGGTCTGTTCAGG + Intergenic
1058907367 9:109492551-109492573 CTGTTGTCAATGAGCTAATGTGG - Intronic
1060481507 9:124018943-124018965 CTGCTGTTAATGAGCTCCGTGGG - Intronic
1061147066 9:128806241-128806263 CTGCTTTTCATAGGCTGATCCGG + Exonic
1187822678 X:23305219-23305241 CAGCTGGGAGTGAGCTGATCTGG + Intergenic
1188523247 X:31061397-31061419 CTGCTGTTAATTGTCTTATCAGG + Intergenic
1191150525 X:57216910-57216932 TTGGTGTAAATGAGGTGATCAGG - Intergenic
1192168370 X:68839977-68839999 CTGCTGGTAGTCAGCTGCTCAGG - Exonic
1196041160 X:111205740-111205762 ATGCAGTTAATCAGCTGAACAGG - Intronic
1196147784 X:112338353-112338375 GTTCTGATAATGAACTGATCTGG - Intergenic
1197454567 X:126662413-126662435 CTGTTGTTACTGAGCTGCTAAGG + Intergenic