ID: 920698839

View in Genome Browser
Species Human (GRCh38)
Location 1:208202601-208202623
Sequence CTGTCTGTGGATTTTGTACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 226}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920698839_920698844 0 Left 920698839 1:208202601-208202623 CCATGTACAAAATCCACAGACAG 0: 1
1: 0
2: 1
3: 13
4: 226
Right 920698844 1:208202624-208202646 GCAAGGCTTAATGGTGTAAAAGG 0: 1
1: 0
2: 0
3: 5
4: 84
920698839_920698843 -9 Left 920698839 1:208202601-208202623 CCATGTACAAAATCCACAGACAG 0: 1
1: 0
2: 1
3: 13
4: 226
Right 920698843 1:208202615-208202637 CACAGACAGGCAAGGCTTAATGG 0: 1
1: 0
2: 1
3: 22
4: 175
920698839_920698845 1 Left 920698839 1:208202601-208202623 CCATGTACAAAATCCACAGACAG 0: 1
1: 0
2: 1
3: 13
4: 226
Right 920698845 1:208202625-208202647 CAAGGCTTAATGGTGTAAAAGGG 0: 1
1: 0
2: 2
3: 10
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920698839 Original CRISPR CTGTCTGTGGATTTTGTACA TGG (reversed) Intronic
903791853 1:25898627-25898649 CTTCCTGAGGATTTTGTACTTGG - Intronic
912184635 1:107260555-107260577 CTGTCTCTGGCTTTTGGTCAGGG + Intronic
912215264 1:107603503-107603525 GTGTCTGTGTATCTTATACAGGG - Intronic
913469575 1:119175132-119175154 ATGTCTCTAGATTTTGTCCAGGG - Intergenic
913803553 1:122752040-122752062 CTGTTTGTGGAATTTGTAAGTGG + Intergenic
913805997 1:122796238-122796260 CTTTTTGTGGAATTTGTAAATGG + Intergenic
913849007 1:123567441-123567463 CTTTCTGTGGAATTTGCACGTGG + Intergenic
914517681 1:148388074-148388096 CTGTCTGCGTAGTTTGTACCTGG + Intergenic
915686594 1:157640344-157640366 CTTACTGTAGATTTTGTAAAAGG + Intergenic
916790541 1:168121413-168121435 CTGTCGGTGAATTTTTTAAAAGG + Intronic
917244936 1:172990055-172990077 CTGTCTTTGCTGTTTGTACATGG + Intergenic
917445743 1:175104682-175104704 ATGTCTCTAGATTTTGTTCAGGG + Intronic
917990735 1:180375875-180375897 TTGTCTGTTGATTTTGTTTATGG - Intronic
918242108 1:182629825-182629847 GTGTCTGCGGATTTTGACCAGGG - Intergenic
919616016 1:199810055-199810077 CTTTCTGTAGATCCTGTACATGG - Intergenic
920672954 1:208018423-208018445 CTGTCTGTGGCCTTAGCACATGG + Intergenic
920698839 1:208202601-208202623 CTGTCTGTGGATTTTGTACATGG - Intronic
920894407 1:210030769-210030791 CTGTGTGTGGCTGTTGCACAGGG + Intronic
924380324 1:243457423-243457445 CTTTCTGTACATTTTCTACAGGG - Intronic
1064061171 10:12138837-12138859 CTTTCTGTGGATATTTTTCATGG + Intronic
1064508282 10:16058822-16058844 ATGTCTTTGGTTTTTGTACCAGG - Intergenic
1065952166 10:30662284-30662306 CTTTCTGTGTAGTTTATACAGGG + Intergenic
1066824898 10:39557159-39557181 CTTTCTGTGGATTTTGCAGGTGG + Intergenic
1066825399 10:39566666-39566688 CTTTCTGTGGAATTTGTAAGAGG + Intergenic
1066827162 10:39609499-39609521 CTTTCTGTGGATTTTGCAAGTGG + Intergenic
1066827291 10:39612212-39612234 CTGTCTGTGGAATTTGCAAGTGG + Intergenic
1066885877 10:40804196-40804218 CTTTCTGTGGAATTTGCAAATGG + Intergenic
1066891468 10:40914522-40914544 CTGTCTGTGGAATTTGCAAGTGG + Intergenic
1066897886 10:41041684-41041706 CTTTCTGTGGATTTTGCAAGTGG + Intergenic
1066898666 10:41056958-41056980 CTGTCTGTGGAATTTGCAAGTGG + Intergenic
1066902157 10:41125891-41125913 CTGTCTGTGGAATTTGCAAGTGG + Intergenic
1067465538 10:46495550-46495572 CTATCTGGAAATTTTGTACATGG - Intergenic
1067621649 10:47889051-47889073 CTATCTGGAAATTTTGTACATGG + Intergenic
1068598013 10:58924769-58924791 CTACATGTAGATTTTGTACATGG + Intergenic
1068811235 10:61257693-61257715 CTGTCTGTAGATTATGGGCAGGG + Intergenic
1070056913 10:72944197-72944219 ATGTTTGTGCATTTGGTACATGG - Intronic
1071262639 10:83934780-83934802 CCTCCTGTGGATTGTGTACACGG - Intergenic
1071591775 10:86881622-86881644 TTCTCTATGGATTTTGTAAATGG - Intronic
1072840920 10:98772796-98772818 TTGCCTGTAGAATTTGTACATGG - Intronic
1074352277 10:112749239-112749261 CTGTCTGTGAATTTGGCATATGG + Intronic
1077199678 11:1299669-1299691 CAGTATGTGCATCTTGTACATGG - Intronic
1077859584 11:6164251-6164273 ATGTCTTTGGTTTTGGTACAAGG - Intergenic
1080982561 11:37425568-37425590 TTGTCTGTGGTTATTGTAAATGG - Intergenic
1081939824 11:46931242-46931264 CAGTCTGGGTATTTTATACATGG + Intergenic
1084211070 11:67622855-67622877 ATGTCTCTAGATTTTGTTCAGGG - Intergenic
1088398474 11:109395333-109395355 CTGTCTGTGGCTTTGGTATCCGG - Intergenic
1089020924 11:115213919-115213941 CTTACTGTTGATTTTGCACATGG - Intronic
1094748185 12:33371220-33371242 GTGTTTCTGGCTTTTGTACATGG - Intergenic
1095491936 12:42744008-42744030 CTGTCATTGGATTTTGTATTGGG + Intergenic
1095634410 12:44416097-44416119 CTTTTTGTGGATATTGTAAATGG + Intergenic
1097295425 12:57957914-57957936 CCCTCTGTGGATTCTGCACATGG - Intergenic
1098574575 12:72026703-72026725 CTGTCTTTGGTTTTTGTGGAAGG + Intronic
1099421631 12:82469105-82469127 CGATCTGTGGATTTTGTGCTGGG - Intronic
1101126147 12:101635341-101635363 CTGTATGTGGATTCTGTATGTGG - Intronic
1102596760 12:113998792-113998814 CTCTCTGTGGATCTTTTATAAGG - Intergenic
1102655976 12:114482545-114482567 GTGTCTGTGTATTTTGGATACGG + Intergenic
1102816529 12:115870470-115870492 CTGTGGGTGGATTTGGTAGAGGG - Intergenic
1103783088 12:123412567-123412589 CTGTGTGTGGACTTTGTATCTGG + Exonic
1104575014 12:129958850-129958872 CTGTCTCTGGAATCTGTCCAAGG - Intergenic
1105784601 13:23735955-23735977 CTGGATTTGGATTTTGTATATGG + Intronic
1107342062 13:39417981-39418003 CTGTCTGTGGATTGGGTGCTAGG - Intronic
1107587035 13:41861688-41861710 CTTTCTGTGGCTGTTGTAAATGG - Intronic
1108817043 13:54305084-54305106 CTGCCTGTGGAGTCTGCACAAGG - Intergenic
1109118324 13:58419522-58419544 CTTTCTGTTAATTTTATACATGG + Intergenic
1109793204 13:67276659-67276681 CTGTTTGTGAATTTTGTAGGTGG - Intergenic
1109901477 13:68778583-68778605 CTTTCTGTGGCCATTGTACATGG - Intergenic
1110492125 13:76121878-76121900 GTGTCTGTGGCTGTTGTAAATGG - Intergenic
1112513148 13:100028102-100028124 CTATCTGTGGATTTTCTTCAGGG - Intergenic
1112788061 13:102973342-102973364 CTGTCTGTGGATTTTCTTCATGG - Intergenic
1113998906 14:16125922-16125944 CTTTTTGTGGAATTTGTAAAGGG - Intergenic
1116769283 14:49108640-49108662 CTGTCTGTTGCTTTTATACATGG - Intergenic
1116780686 14:49234543-49234565 GTGTGTGTGGCTTTTGTAAATGG + Intergenic
1117237240 14:53791168-53791190 CTGTCCCTGGAGTTTGTTCATGG + Intergenic
1119573939 14:75701459-75701481 CTGACTGTGAATTTTGTGTAAGG + Intronic
1119856610 14:77905649-77905671 CTGCCTGTTGTTTTTGTTCATGG - Intronic
1120514514 14:85454383-85454405 CTGTCTGTGGGTCTTGGAGAGGG + Intergenic
1120844895 14:89117048-89117070 TTGTGTGTGGATTGTGGACAGGG - Intergenic
1121144861 14:91574643-91574665 CTGTCTTTGGATTTTTGACTTGG + Intergenic
1123960939 15:25399487-25399509 CTATCAGTTGATTTTGGACAGGG - Intronic
1124108870 15:26767899-26767921 GTGTGTGTGATTTTTGTACATGG + Intronic
1124241991 15:28036437-28036459 CTGTTTGAGGATTTTAAACATGG - Intronic
1127555384 15:60082448-60082470 CTTTGTGTGGATTTAGTACATGG + Intergenic
1127673896 15:61222192-61222214 CTGTCAGTGGGTGCTGTACAGGG + Intronic
1127906655 15:63381214-63381236 CTGTCTGCGGGTTCTGCACAGGG + Intronic
1130426664 15:83807969-83807991 TTTTTAGTGGATTTTGTACACGG - Intronic
1134327150 16:13217591-13217613 CTCTCTGTAGGTTTTGCACAGGG + Intronic
1134900280 16:17932060-17932082 CTATCTGAGCATTTTGCACAAGG + Intergenic
1135265213 16:21019516-21019538 CCTTCTGTGGCTTTTGTAAAGGG + Intronic
1135706781 16:24682056-24682078 CTGTCTGTAAATGTTGTACGGGG + Intergenic
1136011958 16:27369324-27369346 ATGTCTGTGGATTTTGTGGGAGG + Intergenic
1137098413 16:36341316-36341338 CTTTCTGTGGAATTTGCACGTGG + Intergenic
1138124262 16:54425951-54425973 CTGTCCGTGGAGTTGGTTCAAGG - Intergenic
1144790372 17:17855077-17855099 ATGTCTGTGGACTTTGAAAATGG - Intronic
1144938947 17:18923466-18923488 TTGTGTGTTGATTTTGTACTTGG + Intronic
1145098277 17:20050836-20050858 CTGGCTGTGGATATTCTCCAGGG + Intronic
1146427152 17:32751660-32751682 GTGTTTGTGGATATTGTAAATGG - Intronic
1148653123 17:49263891-49263913 ATGTCTATACATTTTGTACACGG - Intergenic
1149006617 17:51812788-51812810 CTGTCTATGGCTTGAGTACAAGG + Intronic
1150232291 17:63562477-63562499 CTGTCTTTTGACTTTGTCCATGG - Intronic
1150629887 17:66872169-66872191 CAGTCTGTGAATTTTGTATACGG + Intronic
1156439164 18:37166665-37166687 CTGTCTGTGGATTCCCTAAAGGG + Intronic
1157946539 18:51987081-51987103 TTGTATGCGGATTTTGTGCAAGG + Intergenic
1158553539 18:58457421-58457443 CTGCCTGTGCATTTTCCACAGGG - Intergenic
1159442324 18:68497227-68497249 CACTCTGTGGATATTGAACAGGG + Intergenic
1164545084 19:29153814-29153836 CTGTATGTGGTTTGTGTTCATGG - Intergenic
1164564802 19:29318167-29318189 CTGGATCTGGAGTTTGTACAAGG - Intergenic
1165338126 19:35187714-35187736 CTTTCTCTGGTTTTTGTACTGGG + Intergenic
1165873954 19:38992595-38992617 CTGTGTCTGGATTCTGGACAAGG + Intronic
926341873 2:11910450-11910472 ATGCCTCTGGATTTTGTTCATGG - Intergenic
926643337 2:15261565-15261587 ATTTCTGTGGTTATTGTACAAGG - Intronic
929354400 2:41002167-41002189 CTGTCTGGTGATTTTGGAGAGGG + Intergenic
930141892 2:47959969-47959991 GTGTCTTTGGTTTTGGTACAAGG - Intergenic
930221418 2:48750212-48750234 CTGTCTGTGGATTCTTTCCTGGG + Intronic
930701467 2:54461397-54461419 CTGTGAGTGGTTTTTGTACACGG + Intronic
930771481 2:55134436-55134458 CTGTCTCTGGACTTTGGACCTGG - Intergenic
930898010 2:56468501-56468523 GTGTCTGTGGCTATTGTAAATGG - Intergenic
931537610 2:63296599-63296621 CTGTATGTTGATTTTGTATTTGG - Intronic
931548646 2:63416890-63416912 TTGTCTGTGGCTGTTATACAGGG - Intronic
933809992 2:86027185-86027207 CTGTCTCTGGATTTTTATCAAGG - Exonic
934744996 2:96753527-96753549 CTGACTGGGGCTTTTATACAAGG - Intergenic
937380046 2:121368205-121368227 CTGTCTGTGGATGTGGGCCAGGG - Intronic
937636580 2:124162907-124162929 CTGTCTTTGGAATTTCTACTTGG - Intronic
939060903 2:137420403-137420425 CTGTCTGTGGTTTTTCAAAAAGG - Intronic
939486719 2:142822543-142822565 ATGTTTGTGGATTTTTTGCATGG + Intergenic
939654596 2:144808017-144808039 CTGTGTATGCTTTTTGTACAAGG + Intergenic
940834572 2:158506561-158506583 CTGATTGTGTATTTGGTACAAGG + Intronic
944754564 2:202746907-202746929 CTGTGTCTGGTTTTGGTACAGGG - Intronic
945798206 2:214390861-214390883 CTGCCTATCAATTTTGTACATGG - Intronic
1168988674 20:2074350-2074372 CTGTCTTTGGTTTTTGTATTAGG - Intergenic
1171734514 20:28759224-28759246 CTTTTTGTGGAATTTGTAAAGGG - Intergenic
1173163212 20:40667727-40667749 GTGTATGTGGATTGTATACATGG + Intergenic
1173911403 20:46673667-46673689 CTATTTGGGGATTTTGTACAGGG - Intronic
1174312251 20:49666658-49666680 TTATCTGTGTATTTTGTATATGG - Intronic
1175684879 20:61021648-61021670 CTTTGTGTGGATTTTGGCCACGG - Intergenic
1176093122 20:63327673-63327695 CTGGCTGTAGATTTTGTGCTAGG - Intronic
1179242593 21:39605266-39605288 CTTTCTCAGCATTTTGTACAGGG + Intronic
1181092740 22:20485390-20485412 CTTTCTGTGTACTCTGTACATGG - Intronic
1181906110 22:26197960-26197982 CTCTCTGTGGATTCTCTAGAGGG + Intronic
1182113043 22:27737004-27737026 CAGTCTGTGGCTTTTCTTCATGG - Intergenic
1183457210 22:37929402-37929424 CTGTGTGTGGAGTTTGTAGTGGG + Intronic
949920642 3:8997465-8997487 CCTTCTGAGGATTTTGAACAGGG - Intronic
950762479 3:15244483-15244505 ATATCTGTGGATCTTGAACAAGG - Intronic
953272322 3:41457706-41457728 CTTTGTGTGCATCTTGTACAGGG + Intronic
957651768 3:83015684-83015706 CTGTCTCTGTATTTTGTGCCAGG + Intergenic
958157921 3:89778526-89778548 CTTTTTGTGGTTTTTGTAAATGG + Intergenic
958381863 3:93316237-93316259 CTTTCTGTGGAATTTGTAAGTGG + Intergenic
958747363 3:98153251-98153273 ATTTCTGTTGATTTTGTTCATGG - Intergenic
959336279 3:105068939-105068961 GTGTGTGTGGCTTTTGTAAATGG - Intergenic
961685874 3:128630555-128630577 CTGTCAGTGTATTTTGATCATGG + Intronic
962061254 3:131929940-131929962 CTGCATGTGGATCTTATACATGG - Intronic
962561602 3:136612146-136612168 CTATGTGTGGATTTTTTATATGG + Intronic
964730827 3:159862549-159862571 CTGTCAGTGGCTTTTGTGCTTGG - Intronic
967861443 3:194154910-194154932 TTGTCTGTGGATGTTTTCCATGG + Intergenic
968537470 4:1143481-1143503 CTGTCTGTGGCTGTTGACCAAGG + Intergenic
972803165 4:42499037-42499059 CTTTCTGTGTATTTTGTACCAGG - Intronic
975303523 4:72820229-72820251 CTGTCAGTGAATTTAGCACATGG + Intergenic
976131214 4:81885986-81886008 CTGTGTGTGGCTATTGTAAATGG - Intronic
976539523 4:86257372-86257394 CTGTGAGTGGATATGGTACATGG - Intronic
977460317 4:97317362-97317384 CAGCCAGTGGATTTTGGACAGGG + Intronic
986076273 5:4340936-4340958 CTGCCTGTGGATTTTACTCAGGG - Intergenic
987900803 5:24009209-24009231 CTGTCTGTGGCTTTTGTGAATGG + Intronic
988037441 5:25845708-25845730 CTTTCAGTTGATTTTGTAAATGG - Intergenic
988223493 5:28380455-28380477 CTTTCTGTGGCTATTGTAAATGG + Intergenic
989550654 5:42732052-42732074 CTGACTTTGAATTGTGTACAGGG - Intergenic
992843503 5:80720039-80720061 CTCTCTGTGGCCTTTATACATGG + Intronic
992916074 5:81454256-81454278 TTGTCTTGGGATTTTGTTCACGG + Intronic
993047254 5:82881353-82881375 GTGTCTGTGCATGTTGTCCAGGG - Intergenic
993245521 5:85446993-85447015 CTTTCTGAGAATTTTCTACATGG + Intergenic
995515005 5:112945459-112945481 CTGTTTGTGGCCATTGTACATGG - Intergenic
997420104 5:133760076-133760098 CTGTCCCTGGAGATTGTACAGGG + Intergenic
997428458 5:133820521-133820543 TTCTCTGTGGATCATGTACATGG + Intergenic
999911005 5:156199138-156199160 CTGCCTGTAGAGTCTGTACATGG + Intronic
1000026643 5:157364304-157364326 CTGCCTCTGGATTCTGAACAGGG - Intronic
1000383090 5:160646629-160646651 CTGGCTGTGGATTTAATACTGGG + Intronic
1000401288 5:160830075-160830097 TTGGCTGTGGATTTTATAGATGG + Intronic
1000612733 5:163392670-163392692 GTGTCTGTGGCTATTGTAAATGG - Intergenic
1002931109 6:1635810-1635832 GTGGCTGTGGGTTATGTACAAGG - Intronic
1003342221 6:5232860-5232882 CTGTTTGTTGATTCTGAACAGGG - Intronic
1004101708 6:12618894-12618916 TTGTCTGTGGATTTCCTACATGG - Intergenic
1004566805 6:16805561-16805583 CTCTCTCTGGATTTTATAAATGG + Intergenic
1005910381 6:30304421-30304443 CTGTCTGGGGATTTTGATCCAGG - Intergenic
1006170655 6:32090127-32090149 CTGATTGTTGATTTTGTACCTGG + Intronic
1006511703 6:34525198-34525220 CTGTCTGTGGTTCTTCTAAAAGG + Intronic
1007534409 6:42572661-42572683 CCATCTGTGGGTTTTGTTCACGG + Intronic
1008566060 6:52769654-52769676 CTGTCTTGGGATTATGTAAATGG - Intergenic
1008570254 6:52809984-52810006 CTGTCTTGGGATTATGTAAATGG - Intergenic
1009928917 6:70153137-70153159 CTGTATTTGGATTTTGTTCGGGG - Intronic
1010044722 6:71427881-71427903 TTGTCTGTGGTTTTTGTAGTGGG + Intergenic
1010139806 6:72601440-72601462 CTGTATGCTGATTTTGTACCTGG + Intergenic
1011324533 6:86135176-86135198 CTGTGTGTGTATTTTATAGATGG - Intergenic
1012385848 6:98681469-98681491 GTGTATGTGGATAGTGTACATGG + Intergenic
1014037775 6:116787708-116787730 GTGTATCTGGATTTTGTACAAGG - Intergenic
1014295164 6:119608906-119608928 CTGTTTGTGGATCTTGTGAATGG + Intergenic
1016632210 6:146246546-146246568 CTTTCTGTGGATTCTGTTCAAGG - Intronic
1018355856 6:163015598-163015620 CTGTATGTGGCTATTGTAAATGG + Intronic
1018617784 6:165704192-165704214 CTGGCTGTGGGTATTGTTCAAGG - Intronic
1019812952 7:3178238-3178260 ATATTTGTGGATTTTGTACTTGG - Intergenic
1020490323 7:8774667-8774689 CTGTGTGTGGCTATTGTAAATGG + Intergenic
1020747050 7:12091398-12091420 CTGGCTGGGGATGTTTTACACGG + Intergenic
1022223275 7:28336171-28336193 CTTTGTGTGGTTTTTGTATAAGG + Intronic
1022426934 7:30278019-30278041 CTGTATGTTGAATTTGCACAGGG - Intergenic
1024301918 7:47893413-47893435 CTGTCTGAGGCTGTTGCACATGG + Intronic
1024341295 7:48264340-48264362 CAGTTTGTGAATTTTGTAAAAGG - Intronic
1027815616 7:82966576-82966598 CTATCTGCTGTTTTTGTACATGG + Intronic
1031269165 7:119623422-119623444 CTGCCTGTTGATTTTGAAGATGG - Intergenic
1031846926 7:126816412-126816434 TTGCCTGTGGACATTGTACAAGG - Intronic
1035626312 8:1073664-1073686 CTGTGTGTGCATTTTGTAGATGG + Intergenic
1038840765 8:31182728-31182750 CTATGTGTGGATTTTGTAGGGGG + Intergenic
1039459420 8:37730972-37730994 ATTTCTTTGGATTTTGGACAGGG - Intergenic
1039558090 8:38491268-38491290 CAGTCTGTGCATTCAGTACAGGG - Intergenic
1040481219 8:47829664-47829686 CTTTCTGTGGCTGTTGTAAACGG - Intronic
1047265551 8:123304515-123304537 CTGTCTTTGGATTTGGTATCAGG + Intergenic
1047760055 8:127947873-127947895 CTGTCTGCCTAATTTGTACAAGG - Intergenic
1049239028 8:141527493-141527515 CTCGCTGTGGTTTCTGTACATGG + Intergenic
1052978728 9:34431299-34431321 CTGTCTGTTGATTTATCACATGG - Intronic
1055465625 9:76562939-76562961 TTGTCAGTTGATTTTGTACCTGG + Intergenic
1055561338 9:77525019-77525041 TGGACTGTGGATTTTTTACATGG + Intronic
1057932363 9:99205810-99205832 TTTTCAGTGGATTTTGTATATGG + Intergenic
1061734397 9:132643455-132643477 CTGTGCGTAGATTTTGTCCATGG + Intronic
1185516283 X:701525-701547 CTGTCTGTGGCTGTTGTCCAGGG + Intergenic
1185747688 X:2584976-2584998 CTCTCTGTGTCTCTTGTACAGGG + Intergenic
1187318229 X:18218325-18218347 TTTTCTGTCGATTCTGTACAAGG + Intronic
1188175781 X:26987062-26987084 GTGTCTGTGGAGTCTGGACAAGG - Intergenic
1190086702 X:47401357-47401379 CTGCCTGTGGATCTTATATAAGG + Intronic
1190667215 X:52706508-52706530 CTTTTTGTGTATTTTGTAGACGG - Intronic
1190672203 X:52751900-52751922 CTTTTTGTGTATTTTGTAGACGG + Intronic
1191259751 X:58303651-58303673 CTTTTTGTGGATTTTTTTCATGG - Intergenic
1192820157 X:74636829-74636851 CTGCCTGTGGAGTCTGCACACGG - Intergenic
1192873218 X:75204720-75204742 CTGTTTGTGCATTTTTTCCAAGG + Intergenic
1192932189 X:75818495-75818517 ATGTTTGTGGTTTTTGCACATGG - Intergenic
1194115079 X:89886659-89886681 ATGTCTGTGGTTTTTGTTCTGGG + Intergenic
1194546721 X:95244558-95244580 TTATGTGTGGCTTTTGTACATGG - Intergenic
1195674150 X:107494523-107494545 AAGCCTGTGGATTTTGTATAAGG - Intergenic
1197017948 X:121650116-121650138 CTGCCTCTGGAGTTTGTAGAAGG + Intergenic
1197643112 X:128988043-128988065 TTGTCAGTTGATTTTGTATATGG + Intergenic
1199923544 X:152436586-152436608 CAGTCAGTTGATTTTGGACAAGG + Intronic
1200467873 Y:3543803-3543825 ATGTCTGTGGTTTTTGTTCTGGG + Intergenic
1201429713 Y:13891775-13891797 ATGTCTCTAGATTTTGTTCAGGG - Intergenic
1201487599 Y:14509144-14509166 ATGTCTCTAGATTTTGTTCAGGG - Intergenic
1201496378 Y:14594569-14594591 ATGTCTCTAGATTTTGTTCAGGG + Intronic
1201740670 Y:17321584-17321606 ATGCCTGTGATTTTTGTACATGG + Intergenic