ID: 920702074

View in Genome Browser
Species Human (GRCh38)
Location 1:208225450-208225472
Sequence CACAGGCACCTGTCTACACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 181}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920702059_920702074 22 Left 920702059 1:208225405-208225427 CCATCCTCCCACATCAGCCCTAG No data
Right 920702074 1:208225450-208225472 CACAGGCACCTGTCTACACCTGG 0: 1
1: 0
2: 2
3: 23
4: 181
920702066_920702074 5 Left 920702066 1:208225422-208225444 CCCTAGGAACCACAGGGATCTGT 0: 1
1: 0
2: 0
3: 14
4: 123
Right 920702074 1:208225450-208225472 CACAGGCACCTGTCTACACCTGG 0: 1
1: 0
2: 2
3: 23
4: 181
920702063_920702074 14 Left 920702063 1:208225413-208225435 CCACATCAGCCCTAGGAACCACA 0: 1
1: 0
2: 1
3: 16
4: 177
Right 920702074 1:208225450-208225472 CACAGGCACCTGTCTACACCTGG 0: 1
1: 0
2: 2
3: 23
4: 181
920702071_920702074 -4 Left 920702071 1:208225431-208225453 CCACAGGGATCTGTGGGGCCACA 0: 1
1: 0
2: 3
3: 42
4: 307
Right 920702074 1:208225450-208225472 CACAGGCACCTGTCTACACCTGG 0: 1
1: 0
2: 2
3: 23
4: 181
920702067_920702074 4 Left 920702067 1:208225423-208225445 CCTAGGAACCACAGGGATCTGTG 0: 1
1: 0
2: 1
3: 23
4: 204
Right 920702074 1:208225450-208225472 CACAGGCACCTGTCTACACCTGG 0: 1
1: 0
2: 2
3: 23
4: 181
920702062_920702074 15 Left 920702062 1:208225412-208225434 CCCACATCAGCCCTAGGAACCAC No data
Right 920702074 1:208225450-208225472 CACAGGCACCTGTCTACACCTGG 0: 1
1: 0
2: 2
3: 23
4: 181
920702061_920702074 18 Left 920702061 1:208225409-208225431 CCTCCCACATCAGCCCTAGGAAC 0: 1
1: 0
2: 0
3: 22
4: 291
Right 920702074 1:208225450-208225472 CACAGGCACCTGTCTACACCTGG 0: 1
1: 0
2: 2
3: 23
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920702074 Original CRISPR CACAGGCACCTGTCTACACC TGG Intronic
902252162 1:15161066-15161088 CACAGGCAGTTGCCTCCACCAGG - Intronic
906705327 1:47890577-47890599 CTCAGTCACCTGTGGACACCTGG - Intronic
908111429 1:60902477-60902499 CACAGTCATGTGTCCACACCTGG + Intronic
920121413 1:203661498-203661520 CACAGGCACCTGGTTACAGCAGG - Intronic
920702074 1:208225450-208225472 CACAGGCACCTGTCTACACCTGG + Intronic
1062763551 10:45362-45384 CACTGGAACCTGCCCACACCTGG - Intergenic
1063410469 10:5833099-5833121 GACAGGCCCCTGACCACACCCGG + Intronic
1064351505 10:14581574-14581596 CACCGGCAGGTGTCCACACCAGG + Intronic
1065673594 10:28149894-28149916 CACACGCATCTGTCTGCACTAGG + Intronic
1066242761 10:33554008-33554030 AACAGGCACCTGTCTGCACAAGG + Intergenic
1069609737 10:69764931-69764953 CACAGGTACCTGTGTGTACCAGG + Intergenic
1069640958 10:69955320-69955342 CACAGCCACCTTTCTCAACCAGG + Intronic
1069971393 10:72173138-72173160 CACAAGTACCTTTCTAGACCTGG + Intronic
1071208726 10:83313519-83313541 GACAGCCACCTGTCTGCTCCTGG - Intergenic
1071593814 10:86902776-86902798 GACAGGCTACTGGCTACACCTGG - Intronic
1072052024 10:91714414-91714436 CACAGGCACTTGTCTCCTTCTGG - Intergenic
1072419751 10:95280232-95280254 TACAGGCACCTGCCACCACCTGG - Intronic
1074403625 10:113162650-113162672 CCCAGGTCCCTGTCTCCACCTGG + Intronic
1075324884 10:121523395-121523417 CCCAGGGACCTGTCCACAGCGGG + Intronic
1075736184 10:124666019-124666041 CACAGGCAGTTGTATACAGCTGG + Intronic
1077153705 11:1082350-1082372 CACGGACACCTGTACACACCGGG + Intergenic
1077267024 11:1655919-1655941 CCCAGGAACCATTCTACACCAGG - Intergenic
1077473784 11:2776950-2776972 CACAGACACCAGTTCACACCTGG - Intronic
1080404933 11:31970686-31970708 CCCAGGGCTCTGTCTACACCAGG - Intronic
1083998363 11:66283226-66283248 CTCAGGCCCCTGTCTGCCCCAGG + Exonic
1084599538 11:70136636-70136658 GACAGGCACCTGACCTCACCAGG - Intronic
1084951228 11:72666678-72666700 CACAGGCATCTGTATACACAGGG + Intronic
1085324016 11:75592927-75592949 CACATGCAGCTGTCTGCTCCTGG + Intronic
1085347327 11:75776649-75776671 CACAGGAAGCTGTCTCCACTTGG - Intronic
1085994392 11:81893422-81893444 CACTGGCACCTGGATACACCAGG - Intergenic
1087602881 11:100338782-100338804 CACAGGCACCTAGCACCACCTGG - Intronic
1089756148 11:120688922-120688944 CACAGAAACCTTTCTGCACCAGG + Intronic
1090262489 11:125331509-125331531 CACAGGCACCTGTCCACACTTGG + Intronic
1091232852 11:133999713-133999735 CTCAGCCACCTGCCTACAGCCGG + Intergenic
1091863100 12:3804555-3804577 TACAGGCGCCTGTCACCACCTGG - Intronic
1097142890 12:56917668-56917690 CAGAGGCCCCTGTCTTCACGGGG + Intergenic
1100466454 12:94849713-94849735 CACAGGCTGCTGCCTGCACCTGG + Intergenic
1101041869 12:100763557-100763579 CACAGTCACCTGTTTACAAATGG + Intronic
1102032837 12:109752980-109753002 CAAAGGAACCTGCCTACCCCTGG + Intronic
1102501478 12:113355947-113355969 CACAGGCACATGCCACCACCCGG + Intronic
1102611478 12:114116142-114116164 CACAAGCACAGGTCTATACCTGG + Intergenic
1102614843 12:114144668-114144690 CACAGGCAGCTGACAACACCTGG - Intergenic
1102963673 12:117110623-117110645 CACAGGTGCCTATCTCCACCGGG + Intergenic
1103328580 12:120138018-120138040 CAACGCCACCTGTCAACACCCGG - Exonic
1104747043 12:131217013-131217035 CACACACAGCGGTCTACACCGGG + Intergenic
1104785575 12:131446172-131446194 CACACACAGCGGTCTACACCGGG - Intergenic
1108180057 13:47831879-47831901 GGCAGACTCCTGTCTACACCTGG + Intergenic
1110579617 13:77106130-77106152 TCAAGGCACCTGTCAACACCTGG + Intronic
1112338262 13:98532207-98532229 CACACTCACCTTTCTACACCTGG + Intronic
1113104397 13:106757670-106757692 CACAGGCACCTGACCAAACGTGG - Intergenic
1115909432 14:38239355-38239377 CACAGTCACATGGATACACCTGG + Intergenic
1117358167 14:54946335-54946357 CACAGCCACCTGGCTAAAACTGG + Intronic
1119934878 14:78582940-78582962 CACACACACCTGTGTACGCCTGG - Intronic
1120250286 14:82054762-82054784 TACAGGCACCTGTCACCACCCGG + Intergenic
1121995726 14:98601472-98601494 CAGAGACAGCTGTGTACACCTGG - Intergenic
1122203112 14:100134465-100134487 CACAGGCCCCTGGCTACAGCTGG + Intronic
1122811382 14:104291096-104291118 CACCTGCCCCTGTCTGCACCCGG - Intergenic
1125520785 15:40346850-40346872 CAGAGGCACCTGCCAACACTAGG + Intergenic
1126532875 15:49730955-49730977 CACAGGAACCTATGCACACCAGG + Intergenic
1127819136 15:62639985-62640007 GATAGGCACCTGTCTATGCCTGG + Intronic
1127968750 15:63942981-63943003 CAGTGGCACCTGTCTTCACTTGG - Intronic
1128217511 15:65944644-65944666 CCCAGGCACCTTTCTAAAACAGG - Intronic
1129276298 15:74447917-74447939 AACAGGTAGCTGTCTTCACCTGG + Intronic
1132685221 16:1159295-1159317 CACAGGCTCCTGTGCCCACCGGG - Intronic
1138858390 16:60723815-60723837 CCCAGGCACATTTCTACATCAGG - Intergenic
1139953143 16:70681503-70681525 CGGAGGCCCCAGTCTACACCTGG - Intronic
1142151304 16:88513634-88513656 CACACACACCTGGCCACACCTGG - Intronic
1142356769 16:89605059-89605081 TTCAGGCACCAGTCAACACCTGG - Intergenic
1142996093 17:3761448-3761470 CACAGGCACCTGTAGCCTCCTGG - Exonic
1143205619 17:5137977-5137999 CACAGTCTCCTGTGTACATCTGG + Intronic
1144876660 17:18400665-18400687 CACAGTCTCCTGTGTACATCTGG + Intergenic
1145155567 17:20543754-20543776 CACAGTCTCCTGTGTACATCTGG - Intergenic
1146207976 17:30921372-30921394 CACATACACATGTCCACACCAGG - Intronic
1152612259 17:81321683-81321705 GACAGGCACCTCTGTCCACCTGG + Intronic
1152943591 17:83185883-83185905 CACAGGCCCCAGCCTTCACCTGG - Intergenic
1152956460 18:45693-45715 CACTGGAACCTGCCCACACCTGG - Intergenic
1154305433 18:13227410-13227432 CACAGGCACCTGAGCACATCAGG + Intronic
1156538708 18:37888780-37888802 CACAGGCACCTCTCAGCACGTGG - Intergenic
1156651622 18:39233224-39233246 CACAGGCACCCACCCACACCTGG - Intergenic
1157330351 18:46699697-46699719 CACAGCCTCCTGTTTGCACCCGG + Intronic
1157519427 18:48335085-48335107 CACAGGCAGCTGTCACCACCAGG + Intronic
1157590835 18:48835770-48835792 CACAGTCCCCTCTCCACACCTGG - Intronic
1157591683 18:48839946-48839968 CACAGGCACTTGAGTCCACCTGG - Intronic
1158710014 18:59829210-59829232 CACAGGCATCTGTCTGCTCCAGG - Intergenic
1159809041 18:72994416-72994438 CACAGGCACCCCACTACAGCTGG + Intergenic
1160230559 18:77045463-77045485 CAGCGGCACCTGCCTGCACCAGG + Intronic
1160743339 19:698037-698059 CACAGGCACCTGCCACCACCAGG + Intergenic
1161572985 19:5040470-5040492 CACACGCACGTTTCTACACAGGG + Intronic
1163130883 19:15272273-15272295 CACAGCCACCTTTCTCCAACTGG + Intronic
1165159264 19:33806259-33806281 GACACACACCTGTCAACACCAGG - Intronic
1165901597 19:39171975-39171997 CACAGGCATCTGTCTGCTCCCGG - Intronic
1167604892 19:50476406-50476428 CACTGGCACCCGTCCGCACCTGG - Exonic
1168262143 19:55201623-55201645 CACAGGGAGCTGTCCACATCAGG + Intronic
1168475662 19:56673406-56673428 CACAGGCACCCACCCACACCAGG - Intergenic
925979527 2:9165652-9165674 CACAGGCCGCTGGCTACACCAGG - Intergenic
926326901 2:11792863-11792885 CCCAGGCCCCTGTGTCCACCTGG + Intronic
927661721 2:24998923-24998945 TACAGGCACCTGCCACCACCTGG - Intergenic
930000849 2:46860569-46860591 CCCAGGCTCCTGACAACACCAGG + Intergenic
931258866 2:60599336-60599358 CACAGGCACCTGCCTGCACCTGG - Intergenic
932304517 2:70692468-70692490 CACAGGCTTCTGTCTGCACTCGG - Exonic
933592012 2:84243565-84243587 CACAGGTGCCTGTCTACCTCAGG - Intergenic
934013257 2:87849624-87849646 CACAGGCACATTTGTACACATGG - Intergenic
934968289 2:98742451-98742473 TACAGGCACCTGACCACGCCCGG - Intergenic
935065140 2:99640969-99640991 CACTGGCAGCTGTCTAGAGCTGG + Intronic
936088394 2:109485244-109485266 GACAGCCACCTGTCTCCACATGG + Intronic
937103533 2:119289884-119289906 CAGAGGCACCGCTCTGCACCAGG + Intergenic
937233226 2:120414312-120414334 CCCACGCACCTGTCAACACCTGG - Intergenic
937906233 2:127054237-127054259 CACAGGCTCCCGCCCACACCAGG + Intronic
938459794 2:131490158-131490180 CACAGGCCCCTGATCACACCTGG + Intronic
938559605 2:132460187-132460209 CACAGGCATCGGACTAAACCAGG - Intronic
940718603 2:157257447-157257469 CATTGGCACCTGGCTACAACAGG + Intergenic
945417849 2:209597526-209597548 CACAGGCACCATTGTACACATGG + Intronic
948792880 2:240388328-240388350 CCCAGGCTCCTGAGTACACCTGG + Intergenic
948792889 2:240388373-240388395 CCCAGGCTCCTGAGTACACCTGG + Intergenic
948792898 2:240388418-240388440 CCCAGGCTCCTGAATACACCTGG + Intergenic
1169422122 20:5469230-5469252 CTGAAGCACATGTCTACACCGGG + Intergenic
1170880870 20:20295842-20295864 CACAGGCATCTCTCTAGGCCTGG - Intronic
1171424867 20:25043027-25043049 CACAGCCTCCTGCCTCCACCAGG + Intronic
1175981826 20:62742601-62742623 CCCAGACACCTGTTTACACAGGG + Intronic
1176059622 20:63166794-63166816 CACGGGCACCTGGATGCACCAGG + Intergenic
1176193604 20:63825983-63826005 CAAAGGCAGCTGTCAACACCGGG + Intronic
1176254266 20:64142659-64142681 CACAAGCACCTGTCCTCACCTGG - Intergenic
1178633180 21:34280326-34280348 AACAGGCAGTTGTCTTCACCAGG + Intergenic
1179444508 21:41421833-41421855 CACAGGCACCTAAGTCCACCTGG + Exonic
1182147157 22:28003571-28003593 CACAGGCTACTGCCTTCACCAGG + Intronic
1182194328 22:28499035-28499057 CACAGGCGTGTGCCTACACCTGG - Intronic
1182444818 22:30383928-30383950 CACTGGGCCTTGTCTACACCTGG - Intronic
1183083063 22:35469558-35469580 CAGGGTCACCTGTCTACAGCTGG + Intergenic
1183964609 22:41434323-41434345 CACAGGCACCCACCCACACCAGG - Exonic
1184187141 22:42872300-42872322 CACAGGCCCCTGCCCACCCCTGG - Intronic
1185215102 22:49594268-49594290 CACAGGGCCCTGTCCACACAAGG + Intronic
949916905 3:8972110-8972132 CACAGGCCCCTGTCGACTGCAGG - Intergenic
954662064 3:52231590-52231612 CAGAGGCACCTGTCTGTTCCGGG - Intronic
954681166 3:52346787-52346809 CGGAGGCACCTGTTGACACCAGG + Intronic
954710705 3:52503899-52503921 CCCAGGCACCTGTGCTCACCTGG - Exonic
956670213 3:71682119-71682141 CACAGGCACTTGCCTACATTGGG - Exonic
961913546 3:130346032-130346054 CACATCCACCTGTCTACTCGAGG - Intronic
962405409 3:135095778-135095800 CACAGGCTGCTCTCTCCACCTGG + Intronic
963160682 3:142148805-142148827 CACAGGCCTCTGTGTCCACCAGG - Intronic
966930492 3:184672589-184672611 CACAGGCCCCCGGCTTCACCTGG + Intronic
968357875 3:198122553-198122575 CACCGGAACCTGCCCACACCTGG + Intergenic
971324596 4:25633700-25633722 CACAGGCACGTGTCTTCAGCTGG - Intergenic
976555108 4:86441771-86441793 GACAAGCATCTGTCTACTCCAGG + Intronic
977476096 4:97511866-97511888 CACAGGTATCTCTCTACACTAGG - Intronic
979095802 4:116549339-116549361 ACCAAGCACCTGCCTACACCAGG + Intergenic
979214297 4:118144319-118144341 CACAGGCACCTGCCACCACACGG + Intronic
980706652 4:136505241-136505263 CATAGGCACATTTCTACATCAGG - Intergenic
980748806 4:137060342-137060364 CACAGGCCCAGGTCCACACCAGG + Intergenic
982163682 4:152595165-152595187 CAGAGGCACCTGTCTGCTGCTGG - Intergenic
982595304 4:157375945-157375967 CACAGGCAACTCTTTACACCTGG - Intergenic
982865042 4:160499844-160499866 TACAGGAACCTGTCTACAAAAGG + Intergenic
983231211 4:165130671-165130693 CACAGGAAACAGTTTACACCAGG + Intronic
984584934 4:181552902-181552924 CACACGCACGTGTTTACACATGG - Intergenic
985440577 4:189980537-189980559 CACTGGAACCTGCCCACACCTGG - Intergenic
985893265 5:2732873-2732895 GACAGGCAGCTGTCTGCATCGGG + Intergenic
986737651 5:10680061-10680083 CCCAGGCAGCTGTGCACACCAGG + Exonic
989447094 5:41542423-41542445 CACAGGCATATGTCTCCAGCTGG - Intergenic
991321917 5:65383622-65383644 CACAGGCACATGACTACAATTGG - Intronic
997852776 5:137347380-137347402 CACAACCACCAGTCTCCACCTGG + Intronic
998462168 5:142317834-142317856 CAGAGGCAGCTGTCAACATCTGG + Intronic
1002310122 5:178309169-178309191 CACAGGCAGATGTCTTCATCTGG - Intronic
1005640772 6:27793937-27793959 CACAGGCACCGTTCTACACGTGG - Intergenic
1006438159 6:34037390-34037412 CAAAGGGACTTGACTACACCTGG + Intronic
1007545317 6:42689077-42689099 GACAGGCACATTTCTACCCCAGG - Intronic
1008381285 6:50842026-50842048 CACAGATACCTGGCCACACCTGG - Intronic
1013129013 6:107213614-107213636 TACAGGCACCTGCCACCACCCGG - Intronic
1016331749 6:142959959-142959981 CACAGACACTTTTCTACTCCGGG - Intergenic
1017674337 6:156797827-156797849 CCCAGGCACCTCTCCTCACCAGG - Intronic
1019183818 6:170209385-170209407 CACAGGCACCTGCATACAATTGG + Intergenic
1019379463 7:713293-713315 CACACTCACCTGTCTACCCCCGG + Intronic
1019702122 7:2479040-2479062 CACGGGCTCCCGTCTGCACCCGG + Intergenic
1019734033 7:2641681-2641703 CCCAGCCACCTCTCTCCACCGGG - Intronic
1023017270 7:35980909-35980931 CACATGGACCTCTCTCCACCAGG + Intergenic
1023212747 7:37825483-37825505 CACAGGCACCTCCATACATCTGG + Intronic
1023273445 7:38492195-38492217 CACAGCCACATGACCACACCTGG - Intronic
1024201966 7:47117203-47117225 CTCTGCCACCTGTCTCCACCTGG + Intergenic
1024255384 7:47536926-47536948 CACGGGCACCAGTGCACACCCGG + Intronic
1025003186 7:55335378-55335400 CACAGACACCTGTGTCCACCAGG - Intergenic
1039458801 8:37726656-37726678 CAGAGGCACCTGTGCAGACCAGG + Intergenic
1039901841 8:41758266-41758288 CTCAGGCTCCTGTGCACACCTGG - Intronic
1041191845 8:55362963-55362985 CACAGTCACCTGGCTGCACAGGG + Intronic
1042999894 8:74745125-74745147 TACAGGCTCCTGACCACACCTGG - Intronic
1045225865 8:100245046-100245068 TACAGGCACCTGCCACCACCCGG + Intronic
1049932944 9:473638-473660 CACAGGCACCTGTGATCATCTGG + Intronic
1050106255 9:2169646-2169668 CAAAGGGTGCTGTCTACACCTGG + Intronic
1052366369 9:27616024-27616046 CACAGGCCCTTGTCTATACAAGG + Intergenic
1053354037 9:37431551-37431573 ATCAGGTACCTGTCTAAACCAGG - Intronic
1054804661 9:69386003-69386025 CAGAGCCACCTGCCTTCACCTGG - Intronic
1057045951 9:91886445-91886467 CACCGCGATCTGTCTACACCAGG + Intronic
1057144162 9:92747346-92747368 CCCAGGCCCCTGGCTACACTGGG + Intronic
1060784533 9:126440081-126440103 CTCAGGCATCTGTCCAAACCAGG - Intronic
1060940048 9:127537984-127538006 CCCAGGCCTCTGTCTCCACCTGG + Intronic
1061385513 9:130287166-130287188 CACAGGCACCTCTCACCGCCAGG + Intronic
1061510658 9:131059053-131059075 TACAGGCACCTAACCACACCTGG - Intronic
1061888412 9:133605068-133605090 CACAGGCCTCGGTCTGCACCTGG - Intergenic
1062416976 9:136456185-136456207 CAAAGGCCCCTGTCACCACCGGG + Intronic
1062551849 9:137091418-137091440 CCCTGGCACTTGTCTAGACCTGG + Intronic
1062741746 9:138179097-138179119 CACTGGAACCTGCCCACACCTGG + Intergenic
1185751314 X:2611657-2611679 CACAGGGACCTGTGCACACAAGG + Intergenic
1187430046 X:19214292-19214314 CAAATGAACCTGTCTACACAGGG - Intergenic
1197340655 X:125263059-125263081 CACAGGCACCTCCCTAGACGGGG - Intergenic
1197618532 X:128721005-128721027 CACAGGAATCTGTATGCACCAGG + Intergenic
1197760434 X:130024274-130024296 CCCAGGCACCTCCCTCCACCCGG - Intronic
1199131214 X:144188845-144188867 CACAGGCACATTTGTACACATGG + Intergenic
1199534155 X:148883186-148883208 CACAAGCACATTTCTACATCTGG + Intronic
1200251832 X:154558077-154558099 CACAGGCCCCAGTCCACACCCGG - Intronic
1200265935 X:154646339-154646361 CACAGGCCCCAGTCCACACCCGG + Intergenic