ID: 920703844

View in Genome Browser
Species Human (GRCh38)
Location 1:208237486-208237508
Sequence CACCCTGGAGTCCTTGCCGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 122}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920703843_920703844 -10 Left 920703843 1:208237473-208237495 CCTTGGGAGTGTGCACCCTGGAG 0: 1
1: 0
2: 2
3: 31
4: 246
Right 920703844 1:208237486-208237508 CACCCTGGAGTCCTTGCCGTAGG 0: 1
1: 0
2: 1
3: 16
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920703844 Original CRISPR CACCCTGGAGTCCTTGCCGT AGG Intronic
901850131 1:12009746-12009768 CACCCTGGAGCCCTAACCTTTGG - Intronic
901872465 1:12146032-12146054 CACCCTGGAACCCTTGCCCCTGG + Intergenic
902517345 1:16996516-16996538 CACCCTGGCTTCCCTGCCTTGGG - Intronic
904871557 1:33622271-33622293 TTCCCTGGTGTCCTTGCCCTAGG - Exonic
906273694 1:44500871-44500893 CACCCTGGAGTCCACAACGTGGG + Intronic
906509974 1:46405367-46405389 CAGCGTGGAGTCCTGGCCCTGGG - Exonic
906707040 1:47902403-47902425 GACCCTGGACTCCTTCTCGTGGG - Intronic
907401773 1:54228903-54228925 CACGCTTGAGTCCTGGCCCTGGG + Intronic
907635007 1:56125395-56125417 CTCCCTGGGGTCCTTGGCCTGGG - Intergenic
908140500 1:61179524-61179546 CACCTTTGAGTCATTGCCATTGG + Intronic
908251724 1:62271227-62271249 CCACCTGGAGTCCTGGCCCTGGG + Intronic
912938301 1:114023001-114023023 CACCCTGGGGTCCATGCTTTTGG - Intergenic
920703844 1:208237486-208237508 CACCCTGGAGTCCTTGCCGTAGG + Intronic
1067469190 10:46523729-46523751 CAGGCTGGAGTCCTGGACGTGGG + Intergenic
1067741297 10:48897774-48897796 CACTCTGCAGTCCTTGCCGTTGG + Intronic
1070286583 10:75087918-75087940 CCCCCAGGAGGCCTTGCCGAGGG + Intergenic
1072626598 10:97116351-97116373 GAACCTGGAATCCTTGCAGTGGG - Intronic
1073303973 10:102488394-102488416 CACCCTGCTGTCCTTGCCCAGGG + Intronic
1076765933 10:132633067-132633089 CACCCAGGAGCCCCTGCCCTGGG - Intronic
1077342791 11:2033438-2033460 CACCCTGGTCTGCTTGCTGTGGG - Intergenic
1077751988 11:4981937-4981959 CACCCTGAAGACCTTCCAGTGGG - Intronic
1077757257 11:5045926-5045948 CACCCTGGAATGCTTGCCCCAGG - Intergenic
1080586312 11:33686011-33686033 CACTCTGGAGTCCATACCCTTGG + Intergenic
1083212817 11:61199515-61199537 CACCCTTGGGTCCTTCCCCTTGG + Intergenic
1083268414 11:61557943-61557965 TTCCCTGGAGTCCTGGCCATGGG - Intronic
1085340378 11:75727489-75727511 CCCCATGGAGTCCTGGCAGTCGG + Exonic
1089092394 11:115888758-115888780 CATCCTGCAGTGCTTGCCTTGGG - Intergenic
1089665033 11:120012965-120012987 CTCACTGGAGTCCTGGCCCTGGG + Intergenic
1090948294 11:131450518-131450540 CTCCCTGAAGTCCTTGTCCTGGG + Intronic
1091359129 11:134960947-134960969 GACCCTGGAGTCTTTGCCCAGGG - Intergenic
1202825777 11_KI270721v1_random:88627-88649 CACCCTGGTCTGCTTGCTGTGGG - Intergenic
1091556233 12:1575631-1575653 CACACTGGGATCCTTGCCGCAGG + Intronic
1095381998 12:41606134-41606156 CACTCTGGCGTCCCTCCCGTGGG - Intergenic
1095952606 12:47789997-47790019 GCCCCTGGGGTCCTGGCCGTGGG - Intronic
1096622429 12:52872968-52872990 CACCCTGGAGCTCATGCTGTTGG + Intergenic
1096727766 12:53578840-53578862 CACACTGGGATCCTTGCCGTTGG + Intronic
1096774114 12:53954002-53954024 CCTCCTGGAGTCTTTGCAGTGGG - Intergenic
1103952511 12:124558713-124558735 GACCCTGGGGTCAGTGCCGTGGG + Intronic
1106755915 13:32822395-32822417 CACCCAGGAGTCATTGCGGGTGG + Intergenic
1108268455 13:48735151-48735173 CATACTGAAGTCCTGGCCGTTGG + Intergenic
1109522940 13:63535486-63535508 CACCTTGGTGTCCTTGCAGTGGG + Intergenic
1110742105 13:79009536-79009558 CACCCTGCTTTCCTTGCCCTAGG + Intergenic
1112563300 13:100532465-100532487 CACGCTGGAGCCCTACCCGTTGG - Exonic
1115376985 14:32687315-32687337 CACCCTGGATTTCCTGCCATGGG + Intronic
1121235956 14:92391362-92391384 CACCCTGGAGACCCTGGGGTTGG - Intronic
1122788919 14:104176300-104176322 CAACCTGGGGTCCGTGCCCTGGG + Exonic
1129106142 15:73308608-73308630 CACACTGGAGTCTCTACCGTAGG - Intergenic
1134487140 16:14667564-14667586 CACCCAGGAGTCCGGGCCCTGGG - Intronic
1135173520 16:20208027-20208049 CCACCTGGAGTCCTTGGCCTTGG + Intergenic
1136498909 16:30659959-30659981 CACCCTCGAGGCCTTGCAGGTGG + Exonic
1138354565 16:56367052-56367074 CTCCCTGGAGAGCTTGCCCTAGG + Intronic
1139512744 16:67436666-67436688 CTCGATGTAGTCCTTGCCGTAGG - Exonic
1139621246 16:68145054-68145076 CACCTTGGCCTCCCTGCCGTGGG + Intronic
1142284013 16:89164333-89164355 CAGCCTGGAATCCTGGCCCTGGG + Intergenic
1143779334 17:9221177-9221199 CCCCTTGGAGGCCTTGCAGTAGG - Exonic
1143883942 17:10052266-10052288 AACCCTGGAGTATTTGCCTTTGG - Intronic
1144825231 17:18102019-18102041 CACTCTGCTGTCCTTGCTGTGGG + Intronic
1145867455 17:28250259-28250281 AACCCTGGAGTTCCTGCTGTGGG - Intergenic
1146538667 17:33675478-33675500 CAACCTGGGGTTCTTGCCTTGGG + Intronic
1148694349 17:49550057-49550079 CACTCTGGAGTCCCTGAGGTTGG + Intergenic
1149782215 17:59407118-59407140 CCTCCTGGAGCCCTTGCTGTAGG + Intergenic
1151536312 17:74740859-74740881 CACCCTGAAGTCTATGCCGACGG - Exonic
1154495851 18:14960293-14960315 GACCCTGGAGTCTTTGCCCAGGG + Intergenic
1161319640 19:3634958-3634980 CAGCCTGGAATCCCTGACGTGGG + Intronic
1161397304 19:4051678-4051700 CAGCCCGGAGACCTTGCCGTGGG - Intronic
1162737016 19:12752345-12752367 TTCCCTGGACTCCTGGCCGTGGG - Intronic
1163244061 19:16081783-16081805 CACCCAGGAGTCCAGGCCATAGG - Intronic
1165923799 19:39314799-39314821 CAACCTGGAGGCCCTGCCGTGGG - Exonic
925930934 2:8707290-8707312 CAGCCTGGATTCCTGGCTGTTGG + Intergenic
927503683 2:23599170-23599192 CAGCCCAGAGTCCTTGCCGCAGG - Intronic
934091026 2:88550336-88550358 CAGCCTGTAGTCCTTGTCATAGG + Intergenic
934793444 2:97082094-97082116 CACCCTGGAGTACTGGCCCTCGG - Intergenic
935520398 2:104096992-104097014 CTCCCTGCAGTCCTTGTCCTAGG - Intergenic
938073526 2:128320268-128320290 CACCCTGGAGTCCATGGTGTGGG + Intergenic
940413626 2:153395064-153395086 CACCCTCAGGTCCTTGCCGTGGG + Intergenic
944878086 2:203983374-203983396 CACCCTCTAGTCCCTGCCCTGGG + Intergenic
947836393 2:233179052-233179074 CACCCTGCATTCCTTGCTGAAGG + Intronic
948247206 2:236496585-236496607 CTCCCTGGAGCCCTTGCTGCTGG - Intronic
948662243 2:239514809-239514831 CACCCTGGGCTCCGTGCCCTCGG - Intergenic
1169376887 20:5073449-5073471 CACCCTGGAGTCCCAGCCAGTGG - Intronic
1173733050 20:45341775-45341797 GATCCTGGAGTTCTTGCTGTGGG - Intronic
1175604375 20:60300041-60300063 CACTCTGGAGTCTGTGCCGTGGG - Intergenic
1176300172 21:5095581-5095603 CAGCCTGGAGTCCTGGCCATGGG - Intergenic
1176675035 21:9769882-9769904 CACCCTGAAGACCTTCCAGTGGG - Intergenic
1179856850 21:44166330-44166352 CAGCCTGGAGTCCTGGCCATGGG + Intergenic
1180185525 21:46137331-46137353 CTCCCTGGGGTCCTTGCAGGTGG - Exonic
1181104977 22:20568783-20568805 ACCCCTGGAGTCCTTGGGGTGGG + Intronic
1181509262 22:23381755-23381777 AACCCTGCAGCCCCTGCCGTGGG - Intergenic
1185239379 22:49734538-49734560 TCCCCTGGAGCCCTGGCCGTGGG - Intergenic
1185351408 22:50341561-50341583 TATCCTGGAGTACTTGCTGTAGG - Intergenic
951711888 3:25591841-25591863 CACGCTGGAGTCCTTTGTGTAGG + Intronic
953412443 3:42697945-42697967 CACCCTGGGGTCCCTGCTGGAGG + Intronic
956514877 3:70035486-70035508 CACCCTGGATTCCTAGCTGCTGG - Intergenic
960081526 3:113545798-113545820 CACTCAGGAGTCCTTGCCTTAGG - Intronic
961469320 3:127101373-127101395 CACCCTGGGGCCCTGGCTGTGGG - Intergenic
964293982 3:155213349-155213371 CACCCTTGACTCCTTCCCTTGGG + Intergenic
967180349 3:186897784-186897806 CAGCCTGGCCTCCTTGCCCTCGG - Intergenic
967192467 3:186996806-186996828 CACTCTAGAGTCCTTCCTGTTGG + Intronic
978120604 4:105074613-105074635 CTCCCTCTAGTCCTTGCCTTTGG - Intergenic
985400519 4:189588810-189588832 CACCCTGAAGACCTTCCAGTGGG + Intergenic
985647945 5:1093860-1093882 CACCCTGGGGTCCCTGCCATGGG - Intronic
985748155 5:1659504-1659526 CACACTTGTGTCCTTCCCGTGGG + Intergenic
986282894 5:6337981-6338003 CTCCCTGGAGCCCTTGCCCTGGG + Intergenic
986310559 5:6547773-6547795 CTCCCTGGAGTCCTCGTTGTTGG + Intergenic
990371241 5:55120507-55120529 CAGTCTGGGGTCCTTGCCATTGG - Exonic
992169722 5:74089655-74089677 AACCCTGAATTCCTTGCCCTGGG + Intergenic
992947696 5:81825467-81825489 CACCCTGGGGCCTCTGCCGTAGG + Intergenic
995865610 5:116686785-116686807 CACCCTGGAGTCCTGGGCACAGG - Intergenic
1001600582 5:172925744-172925766 CACCCTGGAGGCCTTCCTGGAGG - Intronic
1007079085 6:39086090-39086112 CTCCCTGGGGTCCTTGCTGCAGG + Exonic
1010069617 6:71728040-71728062 CACCCTGGAGTCATTGGGGATGG + Intergenic
1011486676 6:87849570-87849592 CACCCTGCAGTCCCTGTCCTTGG - Intergenic
1019273234 7:162264-162286 CACCCGGGAGTCCTTGCAAATGG - Intergenic
1019624692 7:2009996-2010018 CACCCTGGAGTCTGGGCTGTGGG - Intronic
1019924730 7:4184718-4184740 CACACTGGAGTCCTTACCGATGG - Intronic
1022287274 7:28965580-28965602 AGCACTGGAGTCCTTGCTGTAGG + Intergenic
1022507988 7:30918636-30918658 CACCCTGGTGCCCTGGCCTTGGG - Intronic
1022509044 7:30923589-30923611 CACCCTGGAGTTGATGTCGTCGG - Exonic
1023610392 7:41965832-41965854 CACCCTGGAGTCCCTGACCATGG - Exonic
1027892854 7:83998901-83998923 GACCCTGAAGTCCTTCCAGTAGG - Intronic
1028601320 7:92603553-92603575 CCCCCTGAAGTCCTTCCCGTGGG + Intergenic
1031130713 7:117830351-117830373 CTCCATGGAGCCCTTGCTGTCGG - Intronic
1035253362 7:157611539-157611561 CACACTGGAGTCCCAGCCCTGGG + Intronic
1038417021 8:27404528-27404550 CAACCTGGAGTCCCTGCTGCGGG - Intronic
1038720258 8:30028581-30028603 CTCCCTGGGGTCCTTGGCCTGGG - Intergenic
1039498180 8:37997083-37997105 TACCCTGGAGTCCTTCCCGAGGG + Intergenic
1041477109 8:58278827-58278849 CAGCCAGAAGTCCTTGCCCTGGG - Intergenic
1042764069 8:72301473-72301495 CACCATGCAGTCATTGCGGTGGG + Intergenic
1044931904 8:97259464-97259486 CACCATGGAGCCCTTGCTCTTGG - Intergenic
1047777403 8:128084278-128084300 CACACTGGCCTCCTTGCTGTGGG + Intergenic
1048327103 8:133448339-133448361 TCCCCTGGAGTCCCTGCCGAGGG + Intergenic
1048327122 8:133448405-133448427 TCCCCTGGAGTCCCTGCCGAGGG + Intergenic
1053299744 9:36940558-36940580 CACCCTGGGGATGTTGCCGTGGG - Intronic
1057939818 9:99272076-99272098 CACCCTGGTTTCCTGCCCGTTGG + Intergenic
1058948047 9:109877136-109877158 CATCCTGGAAGCCTTGGCGTTGG - Intronic
1061042159 9:128146452-128146474 GACCCTGGAGCCCTTGGAGTCGG + Intergenic
1185445160 X:254009-254031 AACCTGGGAGTCCGTGCCGTCGG - Intergenic
1186126063 X:6415156-6415178 TGCCTTGGAGTCCTTGCCCTAGG + Intergenic
1190264127 X:48817454-48817476 CCCCAGGGAGTCCTTACCGTAGG - Exonic
1192675985 X:73197404-73197426 CACCATGGAGTCCTGTCTGTTGG - Intergenic