ID: 920704517

View in Genome Browser
Species Human (GRCh38)
Location 1:208241955-208241977
Sequence TCTCCTTGGTGGTGGCCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 1, 1: 0, 2: 5, 3: 25, 4: 301}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920704517_920704523 2 Left 920704517 1:208241955-208241977 CCTCCAGGCCACCACCAAGGAGA 0: 1
1: 0
2: 5
3: 25
4: 301
Right 920704523 1:208241980-208242002 TCCCAGGTAATTAGTTCAAATGG 0: 1
1: 0
2: 0
3: 9
4: 155
920704517_920704526 21 Left 920704517 1:208241955-208241977 CCTCCAGGCCACCACCAAGGAGA 0: 1
1: 0
2: 5
3: 25
4: 301
Right 920704526 1:208241999-208242021 ATGGTGCTCCGTGAAGAGAGAGG 0: 1
1: 0
2: 2
3: 11
4: 136
920704517_920704527 22 Left 920704517 1:208241955-208241977 CCTCCAGGCCACCACCAAGGAGA 0: 1
1: 0
2: 5
3: 25
4: 301
Right 920704527 1:208242000-208242022 TGGTGCTCCGTGAAGAGAGAGGG 0: 1
1: 0
2: 0
3: 10
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920704517 Original CRISPR TCTCCTTGGTGGTGGCCTGG AGG (reversed) Intronic
900565119 1:3328373-3328395 TCTCCTTGGTCGTGGGCCAGGGG + Intronic
900799340 1:4727757-4727779 TCTCCATACTGCTGGCCTGGAGG + Intronic
901002257 1:6154666-6154688 CCTCCTTGGTCTTGGCCTTGCGG + Exonic
901435617 1:9245686-9245708 TCTCCTTGAAGGTGGGCAGGAGG + Intronic
902392764 1:16115877-16115899 TCTCCCTCGTGGGGGACTGGGGG + Intergenic
902404940 1:16177445-16177467 TCCCCTTGGTGGTGGCATCTGGG - Intergenic
903042568 1:20542433-20542455 TCTCCTTGGTAGTTTTCTGGTGG - Intergenic
903624440 1:24720878-24720900 TCTTCCTGGCCGTGGCCTGGAGG + Intergenic
903889610 1:26560818-26560840 ACTCCATGTTGGTGGCCTTGTGG - Exonic
905787405 1:40769284-40769306 TCTTTTGGGTGGTGGGCTGGTGG + Intronic
907415327 1:54310393-54310415 TCTACTGGGGGGTGGGCTGGGGG + Intronic
908019130 1:59881648-59881670 TTTACTTGGGGCTGGCCTGGTGG - Intergenic
910428449 1:87138640-87138662 TCTCCTGGGAGGGAGCCTGGTGG + Intronic
912684758 1:111753727-111753749 GGTGCTTGGTGCTGGCCTGGAGG + Intronic
915328247 1:155092367-155092389 TCTCCTCCGGTGTGGCCTGGGGG + Intergenic
918780288 1:188690858-188690880 TCACCATGGTGGTGGGCAGGGGG + Intergenic
920531758 1:206707259-206707281 ACTACTTAGTGGGGGCCTGGAGG - Intronic
920704517 1:208241955-208241977 TCTCCTTGGTGGTGGCCTGGAGG - Intronic
920991752 1:210946362-210946384 CCTCCTTGGTGAAAGCCTGGAGG + Intronic
921534434 1:216328639-216328661 GCTCCTTGGTGGTTGCTTGGAGG + Intronic
921973321 1:221174877-221174899 TGTCCTTGGCTGTGCCCTGGAGG + Intergenic
922572427 1:226642019-226642041 CCTCCTCGGTGGGGGCCTCGGGG + Exonic
922700345 1:227755804-227755826 TCTGCTGGTTGGTGGCCTGCAGG - Intronic
923880144 1:238095034-238095056 TCCCCTTGGGGGTGGCATGGGGG + Intergenic
923880155 1:238095066-238095088 TCCCCTTGAGGGTGGCATGGGGG + Intergenic
1062765798 10:64156-64178 TCTCAGTGGTGGTGGCCTCAGGG - Intergenic
1062791151 10:307499-307521 ACTCCTTGGAGGTGGGCTGGGGG + Intronic
1062912211 10:1218692-1218714 TCCCCTTGGTGCTGTCCTCGTGG + Intronic
1063403766 10:5773155-5773177 CCTCCTGGGTGGTGGGGTGGGGG - Intronic
1065390387 10:25175993-25176015 TCTCCTCGCGCGTGGCCTGGAGG - Exonic
1065930268 10:30472911-30472933 CCCCCTGGGTGGAGGCCTGGGGG + Intergenic
1067553995 10:47255119-47255141 TCTAAGTGGTGGTGGCCTTGGGG - Intergenic
1067694926 10:48527881-48527903 TGTGCCTGGTGGTGGGCTGGAGG - Intronic
1070172135 10:73940850-73940872 ACTGCGTGGGGGTGGCCTGGTGG + Intergenic
1070587989 10:77780690-77780712 CCTCCGTGGTGGTGGCCAGCAGG + Intergenic
1070634207 10:78110929-78110951 CCTCCTTGGTGATGGGCTGCTGG + Intergenic
1071431970 10:85613406-85613428 CCTCCTTGGGGGTCTCCTGGTGG + Exonic
1071752960 10:88502315-88502337 TCTCCTGGGAGGTGGGCGGGGGG + Intronic
1072621684 10:97083953-97083975 GCTCCTGGGTGGTGGCCCAGAGG - Intronic
1073762820 10:106648951-106648973 TCTCCTGGTCGGTGGCCTGCTGG - Intronic
1074304859 10:112267725-112267747 TCTCCCTGGATATGGCCTGGAGG - Intergenic
1074330892 10:112507887-112507909 TCTCATTCGTGGTGGAGTGGGGG - Intronic
1075302824 10:121340658-121340680 TCTCCTGGGCGGCAGCCTGGAGG + Intergenic
1075316144 10:121455171-121455193 TCTCCTTCCTGGTGGCCTTGTGG + Intergenic
1076021831 10:127080216-127080238 ACTCCTTGGTGGAGATCTGGTGG - Intronic
1076112722 10:127873216-127873238 TCTCCTTGGTTGTGGCATGGTGG + Intergenic
1076441020 10:130481440-130481462 TCTCCCTGGTGCTGGTCAGGCGG - Intergenic
1076466302 10:130684310-130684332 TGGCCTTGGGGGTGGCCTTGTGG + Intergenic
1076691359 10:132225272-132225294 ACTCCTTCGAGGTGGACTGGTGG - Exonic
1076727221 10:132419470-132419492 TCTCCTGGTGGGGGGCCTGGAGG + Intergenic
1076727278 10:132419585-132419607 TCTCCTGGGGGGGGGCCTGGAGG + Intergenic
1077145066 11:1041008-1041030 TCTCATTGAGGGTGGGCTGGTGG - Intergenic
1077228969 11:1450277-1450299 GCTCCGTGGAGGTGGCCAGGGGG - Intronic
1077263540 11:1636675-1636697 CCTTGTTGGTGGTGACCTGGAGG - Intergenic
1077472542 11:2770771-2770793 TCTCTCTGGTGCTGGCATGGAGG + Intronic
1077502404 11:2915344-2915366 ACTCCTTGGTGGGGACATGGTGG + Intronic
1079116270 11:17642295-17642317 TCTCACTGGTGGTGGGGTGGAGG + Intronic
1080834488 11:35927771-35927793 CCTCCTTGGCAGGGGCCTGGCGG + Intergenic
1081781800 11:45718204-45718226 TCTCATTTCTGGTGGCCTAGAGG + Intergenic
1083147088 11:60767753-60767775 TCTCCTAGGTGGGGGCCTGGAGG + Intronic
1083367358 11:62149513-62149535 TCTCCTTAGTGGTTCCCAGGAGG + Intronic
1083774135 11:64884948-64884970 TTTCCTTGCTGGTGGTCTGCTGG - Intronic
1084163795 11:67365672-67365694 TCTCCTTGGTGGTGAGCCAGCGG - Intronic
1084579485 11:70014266-70014288 TGTCCTTGGTGGGGGGGTGGGGG - Intergenic
1085453006 11:76648205-76648227 TATCCCTGGTGGTGGCATGAGGG - Intergenic
1085989353 11:81822508-81822530 TCTCTTTTGTGGTGGCTTTGAGG + Intergenic
1087774464 11:102244829-102244851 TCTCCTTTATCCTGGCCTGGTGG - Intergenic
1087816776 11:102666472-102666494 TAGCCTTGGTGGTGGCCTCCGGG + Intergenic
1089009624 11:115121918-115121940 CCACTTTGATGGTGGCCTGGAGG + Intergenic
1089275809 11:117335318-117335340 CCTGCTTGGAGGTGGCATGGTGG + Intronic
1091150436 11:133323649-133323671 TCTCCTGCCTGGTGGCCTAGTGG - Intronic
1092203429 12:6601295-6601317 CCTCCTTGGTCTTGGCCTTGCGG + Exonic
1092252685 12:6909590-6909612 AATCCTCAGTGGTGGCCTGGGGG + Intronic
1093010467 12:14101658-14101680 TCTCCTGAGTTCTGGCCTGGAGG - Intergenic
1094286796 12:28803202-28803224 TCTGCTGGCTGGTGGCCAGGTGG + Intergenic
1096657527 12:53100953-53100975 TGTCCTGGGTGCTTGCCTGGTGG + Intronic
1096714520 12:53483041-53483063 TCCCCTTGGCGCTGGCCTTGCGG + Exonic
1098203372 12:68080757-68080779 TCTCTGTAGTGGTGGGCTGGTGG - Intergenic
1098281868 12:68870245-68870267 CCTCCATGGTGGTGCCCTCGTGG - Exonic
1098544697 12:71698940-71698962 TCTCCTTGGTGGTACCTTTGTGG + Exonic
1099407478 12:82281851-82281873 TCTACTAGGTAGTGCCCTGGTGG - Intronic
1099973503 12:89524581-89524603 TCCCCTGCGTGGTGGCTTGGTGG - Exonic
1100018526 12:90041864-90041886 TCTTCTGGGAAGTGGCCTGGCGG + Intergenic
1101607577 12:106259145-106259167 TCTCAGTGGTGGTGGCCACGGGG + Intronic
1101817138 12:108153842-108153864 TCCACCTGGAGGTGGCCTGGGGG - Intronic
1101839435 12:108317153-108317175 CCTGTTTGGTGGTGGGCTGGAGG + Intronic
1103209379 12:119155361-119155383 TCTCCCTGGAGATGACCTGGAGG + Intronic
1103423868 12:120813909-120813931 GCTCCTTGGAGGGGGCCTGAGGG - Intronic
1104857522 12:131909055-131909077 TCTGGTTGGCTGTGGCCTGGCGG + Intronic
1105063299 12:133173367-133173389 TCCCCTTGGTGCTGTCCTTGAGG + Intronic
1106721691 13:32441394-32441416 TTTCTTTTCTGGTGGCCTGGTGG + Intronic
1106947216 13:34842121-34842143 TCCCCTTGGTGCTGTCCTTGTGG + Intergenic
1107156171 13:37169436-37169458 TCTTCTTGGTGGAGGCCTGGAGG - Intergenic
1107632414 13:42355729-42355751 TCTCACTGGTATTGGCCTGGTGG + Intergenic
1109714283 13:66200872-66200894 TGTCCTTGGTGGGGGTCAGGGGG + Intergenic
1110823292 13:79941822-79941844 TCTGGTTGGAGGTAGCCTGGTGG + Intergenic
1112578942 13:100662102-100662124 TATCCTCAGTGGAGGCCTGGAGG - Intronic
1118612640 14:67553651-67553673 TCTCCTTGGTGGTGGGGGGTTGG - Intronic
1118720173 14:68588347-68588369 TCTCCTAGGTAGTTGCCTTGGGG - Intronic
1121508416 14:94493891-94493913 TGTGGTTGGTGGTGGCCTGATGG + Intronic
1122488641 14:102098056-102098078 TCTCCCTGGAGGTGGCAGGGAGG - Intronic
1122722598 14:103730581-103730603 TCCCCCTTGTGGTGGCTTGGGGG + Intronic
1122817932 14:104322998-104323020 CCGCCTTGGTGCTGTCCTGGAGG - Intergenic
1122835247 14:104427590-104427612 TCTCCCTGGAGGTCGCCTGGTGG + Intergenic
1122938395 14:104970368-104970390 CCCCCTTGCTGGTGGCCTGCTGG + Intronic
1122996765 14:105269312-105269334 TCTGGCTGCTGGTGGCCTGGTGG - Intronic
1124638500 15:31380326-31380348 ATTCCTTGGTGCTGGCCTGTAGG + Intronic
1124818317 15:33018776-33018798 TCTCCCTTCTGGTGGGCTGGTGG + Intronic
1124883426 15:33662369-33662391 TCTCCTTGGCGCTGGCCAGGTGG - Exonic
1126329905 15:47521058-47521080 TCTCATAGGTGTTGGCTTGGAGG + Intronic
1127682320 15:61309877-61309899 TCTCCTTGGGTGTGGCCAGTGGG + Intergenic
1128068582 15:64779434-64779456 GCTCCTTGCTGGAGGCCAGGGGG - Intergenic
1128278008 15:66370459-66370481 TGTCCTTGGTGGGGGGCTGGAGG + Intronic
1129257071 15:74339594-74339616 TCTCCTTGATGCTGGCTTTGAGG + Exonic
1131940571 15:97560291-97560313 TCTCCTTGGTGTTAGCCAGCAGG + Intergenic
1133916283 16:10112540-10112562 CCTCCGTGGTGGTGGCCAGCAGG - Intronic
1137847854 16:51709632-51709654 TCTGTTTGGAGCTGGCCTGGAGG + Intergenic
1138030100 16:53552999-53553021 TCTCCTTGCTGGTGGTCAGCTGG - Intergenic
1138433902 16:56986469-56986491 TCTGCCTGGTGCTGGCCTTGGGG - Intergenic
1138532364 16:57641347-57641369 GCTCCTTGGAGATGGCCAGGTGG + Intronic
1139275417 16:65723363-65723385 TCTCCTTGCTACTGGGCTGGAGG - Intergenic
1142032042 16:87843470-87843492 TCTGCTTAAGGGTGGCCTGGAGG + Intronic
1142742573 17:1939825-1939847 CCTCCAGGGTGGGGGCCTGGAGG - Intronic
1143185836 17:5009499-5009521 TCTCCTTGGGTCGGGCCTGGTGG + Intronic
1143369451 17:6429366-6429388 TCTCTGTGCTGGTGACCTGGAGG - Intronic
1144783034 17:17817329-17817351 CCTCCTTGCTGGGGGCCCGGGGG - Exonic
1145103313 17:20094534-20094556 TCTCTTTTGTGGTGGTGTGGTGG + Intronic
1145790564 17:27624162-27624184 TCACCTTGGTGCCTGCCTGGGGG - Exonic
1146716218 17:35089118-35089140 TCTCCTAGGTGCCGGCCGGGAGG - Exonic
1146744956 17:35320209-35320231 TCTCAGTGGTGGTGGCCTCAGGG - Intergenic
1146970052 17:37065266-37065288 TCTCCTGTGGGGAGGCCTGGGGG + Intergenic
1147186400 17:38715641-38715663 TCTCCTGCGTGCTGGCCTCGTGG - Exonic
1147597133 17:41724494-41724516 TCTCCTGGGGGCTGGGCTGGGGG - Exonic
1147645210 17:42029136-42029158 TGACCATGGAGGTGGCCTGGAGG + Intronic
1147654107 17:42078755-42078777 TCTCCCTGGGGGTGGCCTCAGGG + Intergenic
1148812272 17:50301048-50301070 GCTCCTTGGTGGTGGTGTGGAGG + Intergenic
1151405566 17:73883947-73883969 TCACCTTGGAGGTGCCCTAGAGG - Intergenic
1151822834 17:76506422-76506444 TCTCCCTGCTGGAGGCCTGGGGG - Intergenic
1152206727 17:78978174-78978196 GCTGCTTGGAGGGGGCCTGGTGG + Intronic
1153554592 18:6298167-6298189 ACTCCTTGCTGGTGGGATGGGGG - Intronic
1155930398 18:31701205-31701227 TCTCCTTGGTGCTGTTCTTGTGG + Intergenic
1158548668 18:58416943-58416965 TCCACTTGCTGGTGGCCTGTCGG + Intergenic
1161204844 19:3035637-3035659 TCTCCGCGGTGGTTGGCTGGGGG + Intronic
1161578667 19:5068577-5068599 TGTCCTTGGGGGTGGCCGGGAGG + Intronic
1162402295 19:10453500-10453522 TCTCCCTGGGGGTGGACTGCGGG + Intronic
1162532835 19:11245754-11245776 TCTCCTTGTTGGGGGGCTGTGGG - Intronic
1163218538 19:15897927-15897949 GCTCCTGGGTGCTGGCCTGGAGG - Intronic
1163382317 19:16977295-16977317 TCTCCAAGGTGCTGGCCAGGGGG - Intronic
1163516026 19:17764369-17764391 TCTCCTCGATGGTGGCCCTGGGG - Exonic
1163664990 19:18598979-18599001 ACTCCAAGGTGGGGGCCTGGTGG - Intronic
1164536008 19:29087146-29087168 ACTCCAGGGTGGTGGCCGGGAGG + Intergenic
1164928005 19:32145663-32145685 TCTCCTTGCCAGTGGCCTTGTGG - Intergenic
1166064373 19:40348476-40348498 TCTCGCTGGTGGCGGCCTGTTGG - Exonic
1167158785 19:47754825-47754847 TCTTCTCTGTGGTGGCCAGGCGG - Exonic
1168643519 19:58045371-58045393 TCTCCTGGATGGTGTCCTGGAGG - Intronic
1168717551 19:58538386-58538408 TCTTCAGGGTGGTGGGCTGGAGG + Intronic
925786127 2:7432431-7432453 TCTCCTTGTGGGTGGCCGCGTGG - Intergenic
926434930 2:12827931-12827953 TCTGCTGGTTGGTGGCCTGCCGG + Intergenic
927089623 2:19700647-19700669 TCTGCTGGGTGGTGGCCTGGTGG - Intergenic
927524139 2:23721636-23721658 TCTTCTGGGTGGTGGCCCAGAGG - Intergenic
928242969 2:29602460-29602482 TCTCCAAGCAGGTGGCCTGGTGG - Intronic
929533137 2:42764591-42764613 CCGCCCTGCTGGTGGCCTGGAGG + Intergenic
931510375 2:62985127-62985149 TCTCCATAGTGCTTGCCTGGGGG + Intronic
931694986 2:64864986-64865008 TCTCCGGGGTGGGGTCCTGGGGG - Intergenic
934755651 2:96822956-96822978 GCTCCTTGGAGCTGGCCTGTGGG + Intronic
935222586 2:101028053-101028075 TCTGCTTTGTGGTGTCCTCGTGG + Exonic
935663167 2:105487498-105487520 TTTCCTTGGTTGTGGTCTGAAGG + Intergenic
937816294 2:126254207-126254229 TCTCCTTGGTGGAGTACTGAGGG + Intergenic
938992782 2:136646469-136646491 TGTCAGTGGTGGTGGCCTGCAGG - Intergenic
942156350 2:173132541-173132563 TCTCCTGGGTGGAGGCAAGGAGG - Intronic
942578522 2:177392454-177392476 TGTCCTCGGGTGTGGCCTGGGGG - Intronic
942712165 2:178848762-178848784 GCTCCTCGGTGGTGGGGTGGAGG + Intronic
943013238 2:182477889-182477911 TCTCTTTTGTGGAGGACTGGGGG + Intronic
945830605 2:214780061-214780083 GCTCCTTTGTGGTGAACTGGAGG + Intronic
946113402 2:217439851-217439873 ACTCCTGGGTGGTGGGGTGGGGG - Intronic
946898970 2:224354466-224354488 TCTCGTTGGTGGAGCTCTGGAGG - Intergenic
948851660 2:240711315-240711337 TCTCCTGGCTGGGGGCCTGGCGG + Intergenic
1169404607 20:5313443-5313465 TCAGATTGGTGGTTGCCTGGTGG + Intronic
1170270995 20:14527134-14527156 TCTGCTGGTTGGTGGCCTGCTGG + Intronic
1172025796 20:31947485-31947507 TGCACTTGGTGGTGGGCTGGAGG - Intronic
1172463510 20:35137731-35137753 TTTCCATGGTGGGTGCCTGGTGG + Intronic
1172753478 20:37267684-37267706 GCTGCTTGGTGGCAGCCTGGTGG + Intergenic
1175544119 20:59767232-59767254 GCTCATTGGTGGTGGGCAGGAGG - Exonic
1175914616 20:62419854-62419876 ACTCATGGGAGGTGGCCTGGAGG + Intronic
1175936101 20:62514794-62514816 TCTCCATCGTGGGGGCCTGTCGG + Intergenic
1179576922 21:42313560-42313582 ACTCCTTGGGGGTGACATGGGGG + Exonic
1179912921 21:44459822-44459844 TCTCCTTGGTGAAGGTCTGCTGG + Exonic
1180787939 22:18557383-18557405 GCTCCTTGGGAGTGGGCTGGGGG - Intergenic
1181233799 22:21437935-21437957 GCTCCTTGGGAGTGGGCTGGGGG + Intronic
1181244851 22:21496908-21496930 GCTCCTTGGGAGTGGGCTGGGGG - Intergenic
1181322586 22:22019706-22019728 TCTGGTGGGTGGTGGCCTGTGGG + Intergenic
1181322594 22:22019731-22019753 TCTGGTGGGTGGTGGCCTGTGGG + Intergenic
1183240281 22:36652722-36652744 TGTGCTTGGTGGTGGCTTGCTGG - Intronic
1184258346 22:43300123-43300145 TCTCCTGGGTGGATACCTGGGGG + Intronic
1184802470 22:46769929-46769951 TCTCCAGGGTGCTGGCCTGAGGG + Intronic
949299420 3:2566593-2566615 TCTATTTGGTGGGGGCCAGGAGG + Intronic
950216336 3:11162345-11162367 TCTCCTTGGTGGGGGAGTGCGGG + Intronic
950815747 3:15700292-15700314 TGTCCGGGGTGGGGGCCTGGGGG + Intronic
951851068 3:27140376-27140398 TCTCCTTGGGGGAGGTTTGGAGG - Intronic
954196995 3:49002794-49002816 TCCCCTTGGTGATGGTCTCGAGG + Intronic
954466909 3:50660660-50660682 CCCCCTTGGATGTGGCCTGGAGG - Intergenic
954692266 3:52401873-52401895 TCTCCTAGGAGCTGTCCTGGTGG - Exonic
954871373 3:53769807-53769829 TCTCCTTGGAGGTGGACTTGAGG - Intronic
955337231 3:58096840-58096862 TCTCCTTGGAGGTGCTCTGGAGG + Intronic
955403240 3:58608688-58608710 CCCCCTTGGAGGTGGCATGGGGG + Intronic
956796529 3:72723192-72723214 GCTCCTTGGTGGTAGCCAAGTGG - Intergenic
957998029 3:87716121-87716143 TCTCCATTCTGTTGGCCTGGGGG - Intergenic
958632197 3:96699267-96699289 TCTCATTGGTGGTGGCCCAAGGG - Intergenic
961818079 3:129561509-129561531 CCTCCTTGGTGGGGGCTGGGCGG - Intronic
961862490 3:129927743-129927765 TCTCCTCTGTCGTGTCCTGGCGG - Intergenic
964464440 3:156974978-156975000 TATCATTGGTGGTGGCATGAAGG - Intronic
964784908 3:160385785-160385807 TCTAATTGGTGGGGGCCTGATGG - Intronic
965997280 3:174899437-174899459 TCCCCTTGGTGGTGTCCTCCAGG + Intronic
967003740 3:185363226-185363248 GCTCCTTTGCGGTGGGCTGGAGG + Exonic
967195730 3:187023950-187023972 TCTACTTTGTGGTGGCCCCGGGG - Intronic
967216268 3:187213125-187213147 TCTGGTTGGTGCTGGCCTGTTGG + Intergenic
967416037 3:189219575-189219597 TCTCCTTGGTGCTGGCTTAATGG - Intronic
968444263 4:641471-641493 TCTCCTTGGTCATGTCCAGGGGG + Intronic
968446284 4:653968-653990 TCTCCTTGGTCATGTCCAGGAGG - Exonic
968668545 4:1834910-1834932 TCTCCTCGATGGTGTCCTGGAGG + Exonic
968731171 4:2270046-2270068 TCCCCTTGCTGATGGCATGGGGG - Exonic
968743072 4:2340965-2340987 TCCGCATGGTGGGGGCCTGGGGG + Intronic
968948910 4:3680149-3680171 CCTGCTTGGAGGTGGGCTGGAGG + Intergenic
971531548 4:27695035-27695057 TCTCCTTTCTGGAGGCCTTGTGG + Intergenic
976619730 4:87115337-87115359 CATCCTTGCTGTTGGCCTGGCGG + Intronic
976891071 4:90048444-90048466 TCTTCTTGATTGTGGCCTCGGGG + Intergenic
977479602 4:97558578-97558600 TCTCCTTGGCTGTTGGCTGGAGG - Intronic
977779050 4:100958641-100958663 TCTCCCTGGTGCTGTCCTTGTGG - Intergenic
979881374 4:125963789-125963811 GATCCTTGGTGGTGTCCAGGTGG + Intergenic
981659505 4:147149080-147149102 CCTTGTTGGGGGTGGCCTGGTGG - Intergenic
982435164 4:155376767-155376789 TCACCTTGGTCTGGGCCTGGCGG + Exonic
984409028 4:179371489-179371511 TCTCCTTAATGGGGGGCTGGTGG - Intergenic
984878303 4:184388925-184388947 CCTCTTTGATGGTGACCTGGAGG + Exonic
985134426 4:186771437-186771459 TGTCCTTGGTGGTGGGGGGGGGG - Intergenic
985860118 5:2464272-2464294 CCTCCATGCAGGTGGCCTGGCGG + Intergenic
986756425 5:10840451-10840473 TCTCAGTGGTGGTGGCCATGGGG + Intergenic
988038122 5:25853566-25853588 TCTGCTGGTTGGTGGCCTGCTGG + Intergenic
989111032 5:37906847-37906869 GCTCCTTGGTGGTGTCCTGGGGG + Intergenic
989322998 5:40158926-40158948 TGTCCAGGGTGGAGGCCTGGAGG + Intergenic
990237627 5:53784565-53784587 TCTCCTTGGTGTGGGGGTGGGGG + Intergenic
992149677 5:73890685-73890707 ACTCCTTGGTGCTGGCTTGTCGG - Intronic
993649811 5:90506391-90506413 TTTCCTAGGTGGTAGCCAGGAGG + Intronic
997284450 5:132668182-132668204 TCTCCTGGGTGCTGGCCTGCAGG + Intergenic
997340525 5:133141117-133141139 TCTGCTTGGGGGTGGCCTTCTGG + Intergenic
997359014 5:133282546-133282568 TCTTCTTGGGGGTGAGCTGGAGG + Intronic
997915139 5:137917116-137917138 TCTACTTGATGGTGTCCTGCAGG + Intronic
998309216 5:141110407-141110429 TCTGTTTGGTGGTTCCCTGGAGG + Intronic
998950467 5:147388638-147388660 TCTCCTTTGTGATGGGTTGGTGG + Intergenic
999211708 5:149895174-149895196 TCTCCCTGCTGGTGGTATGGCGG - Exonic
999277544 5:150341388-150341410 TCTGCTTGATGGGTGCCTGGAGG + Intergenic
999573439 5:152946717-152946739 TATCCTTGGTGGGGGCATGCAGG - Intergenic
999904429 5:156123930-156123952 TCCCTTTTGTGGTGGCCTGAGGG + Intronic
1000041377 5:157487524-157487546 TTTCCTGGGTGGCGGCCGGGTGG - Intronic
1001075518 5:168624777-168624799 TCTCCTGGGAGGTGGAGTGGGGG - Intergenic
1001567772 5:172711628-172711650 GTTCCTAGGTGGTGGCTTGGAGG - Intergenic
1001587678 5:172844549-172844571 GCTCGTGGGAGGTGGCCTGGTGG + Intronic
1001621543 5:173089946-173089968 TCTCCTTAGTGGTGGTAGGGTGG - Intronic
1002087950 5:176787525-176787547 TCTCCATGGTGGGGGCGGGGGGG + Intergenic
1002792814 6:448133-448155 CCTCCATGGCAGTGGCCTGGAGG - Intergenic
1003566976 6:7230265-7230287 TATCCTTGCGGGTGGCCTTGAGG - Exonic
1004327287 6:14686784-14686806 TGTACTTGTTAGTGGCCTGGGGG + Intergenic
1004515822 6:16321506-16321528 GCACCTAGGTGGGGGCCTGGGGG + Intronic
1006533281 6:34675903-34675925 CTTCCTTGTTGCTGGCCTGGTGG - Intronic
1006860857 6:37170707-37170729 TCTCCTGGGTGGGGAGCTGGCGG + Intronic
1007024189 6:38552894-38552916 TATCCTTGGTGGGGGTTTGGGGG - Intronic
1007039020 6:38704248-38704270 ACATCTTGGTGGTGGCCAGGTGG - Intergenic
1007762045 6:44138953-44138975 TACCCTTGGGGGAGGCCTGGGGG - Intronic
1013232288 6:108169280-108169302 TCGCACTGGTGGTGGCCTAGAGG + Intronic
1014300535 6:119676085-119676107 TCTCCTCAGTGGTGGACTGATGG - Intergenic
1014698761 6:124657006-124657028 TCTCCATGGTGGTGGTTGGGTGG - Intronic
1016932978 6:149427708-149427730 TCCCTTTGGTGGAGGACTGGGGG + Intergenic
1017232932 6:152092108-152092130 TGGCCGTGGTGTTGGCCTGGAGG - Intronic
1017690735 6:156961585-156961607 TCTTCTTGGTGGAAGCCTGGTGG + Intronic
1018704052 6:166450279-166450301 TCCCCGTGGTGGTTCCCTGGTGG - Intronic
1018915493 6:168130177-168130199 TCTCCTTGATGGAGGCCTCTGGG + Intergenic
1019046793 6:169155742-169155764 CCTCCTTGGTGACGCCCTGGTGG - Intergenic
1020086292 7:5312604-5312626 GCTCCTTGGTGGTGGGGAGGTGG + Exonic
1020688282 7:11322909-11322931 TCTCCTGGATGGAGGCCTAGAGG + Intergenic
1022097606 7:27150734-27150756 TCTCCATGGTGCTGGAGTGGGGG + Intronic
1023873423 7:44274710-44274732 TCTGCTGGCGGGTGGCCTGGAGG + Intronic
1024006726 7:45229767-45229789 TCTCCCAGGAGGTGGCGTGGTGG - Intergenic
1025208015 7:57004468-57004490 GCTCCTTGGTGGTGGGGAGGTGG - Intergenic
1025663938 7:63572407-63572429 GCTCCTTGGTGGTGGGGAGGTGG + Intergenic
1026371243 7:69701829-69701851 GCTCCTTGGTGGTGGAGTTGGGG + Intronic
1026977769 7:74508809-74508831 TCTCCTAGCAGGTGACCTGGGGG + Intronic
1026990362 7:74581629-74581651 ACTCCCTGGTGGCGACCTGGTGG + Intronic
1027268074 7:76504875-76504897 TACCCCTGGTGCTGGCCTGGGGG - Intronic
1029251821 7:99242302-99242324 TATCCTTGAAGGTGGCTTGGAGG + Intergenic
1029989293 7:104948321-104948343 TCTTCTTGGTGGAGGGTTGGAGG + Intergenic
1032469751 7:132169737-132169759 TCTGCTTGGTGCTGGCTTGAGGG + Intronic
1032482034 7:132254986-132255008 TCTCAGGGGGGGTGGCCTGGGGG + Intronic
1034975680 7:155448232-155448254 TCTCCTGGGGGGTGGCCAGCTGG + Intergenic
1036730249 8:11256543-11256565 TCTCCTTCTTTTTGGCCTGGAGG - Intergenic
1037513875 8:19610585-19610607 TCTGCTGGTTGGTGGCCTGCTGG - Intronic
1037805274 8:22055236-22055258 TCTCCTGGGGTGGGGCCTGGTGG + Intronic
1039439431 8:37584471-37584493 GCTCCAGGGTGGTGGCCTGAGGG - Intergenic
1039544654 8:38400864-38400886 TCTCCTTTGTGCTGGGCTTGTGG - Exonic
1041566571 8:59285231-59285253 TCCTCCTGCTGGTGGCCTGGTGG + Intergenic
1042575993 8:70219466-70219488 TCCCCTTGGTGGTGGAAAGGTGG - Intronic
1044273271 8:90271813-90271835 CCTTCTTGGTGGCTGCCTGGTGG - Intergenic
1045173548 8:99696647-99696669 TCTCCTCGATGGTGTCCTGGAGG - Intronic
1047865226 8:129016376-129016398 CCTCCCTGGTGGGGACCTGGTGG - Intergenic
1047899466 8:129404216-129404238 TCTCCATGGTGGTGGCAGGCTGG + Intergenic
1048430748 8:134368337-134368359 TCTCTCTGGTGGTGTCTTGGAGG - Intergenic
1049766178 8:144356271-144356293 AGTCCTGGGTGGTGGCCGGGCGG - Intronic
1051008074 9:12373622-12373644 TCTCCTTGATGGGAGCCTGAGGG - Intergenic
1053382999 9:37664223-37664245 TGCCCTTGGTGGTGGGGTGGGGG + Intronic
1057797412 9:98168955-98168977 TCTCCTAGGTGGAGGCCAGAAGG + Intronic
1059788714 9:117616512-117616534 TGTGCTTGGTGGTGGAGTGGAGG + Intergenic
1060934359 9:127506871-127506893 TGTCCTCGGTGGTGGTGTGGAGG + Exonic
1061650793 9:132048327-132048349 TCTCCGTAGTGGTTGACTGGAGG - Intronic
1061806644 9:133140771-133140793 GTTCCTTGGTGCTGGGCTGGGGG + Intronic
1061813972 9:133182169-133182191 GCTCCATGCTGGGGGCCTGGTGG + Intergenic
1061814856 9:133188574-133188596 GCTCCCTGCTGGGGGCCTGGCGG + Intergenic
1061818063 9:133207974-133207996 TCTCCTTCCTGGGGGGCTGGTGG - Intronic
1061996007 9:134186427-134186449 TTTCCTTGGTGGTGGTCTTGAGG + Intergenic
1062086221 9:134650328-134650350 TCTGCTGGCGGGTGGCCTGGGGG + Intronic
1062106101 9:134755884-134755906 TCTGCTTGGTGGTGGGTTGGGGG + Intronic
1062242391 9:135547380-135547402 TCTCCTTCCTGGGGGGCTGGTGG + Intronic
1062582922 9:137236347-137236369 CCTCTTTGGTGGTGGCCTTCGGG - Exonic
1062609304 9:137366833-137366855 TCTCCATGATGAAGGCCTGGAGG + Intronic
1188205778 X:27355963-27355985 CCTCCTTGGGGGTGGCGGGGCGG - Intergenic
1189361905 X:40359542-40359564 CCTCCGTGGTGGTGGCCAGCAGG + Intergenic
1189515419 X:41709172-41709194 TTTCCTTGGTGGTGGCATCTTGG - Intronic
1190128614 X:47726427-47726449 ACTCCTTGGTGGTGGTCAGGGGG + Intergenic
1192845325 X:74901318-74901340 TCTCCTAGGTTGTTTCCTGGAGG + Intronic
1193811162 X:86053681-86053703 TGTCGTGGGTGGGGGCCTGGGGG - Intergenic
1194586186 X:95736850-95736872 TCTCCTTGGTGGTGGCCACAGGG + Intergenic
1195322402 X:103730274-103730296 GCTCCTTGCTGGGGGTCTGGCGG + Intergenic
1196144926 X:112306014-112306036 GCTCCTTGGTGGTGGCTTGAGGG + Intergenic
1201068554 Y:10123370-10123392 TCTGCTTTGTAGTAGCCTGGAGG + Intergenic
1202036525 Y:20642047-20642069 TCTCCTTGATGGTGAACAGGAGG - Intergenic