ID: 920704517

View in Genome Browser
Species Human (GRCh38)
Location 1:208241955-208241977
Sequence TCTCCTTGGTGGTGGCCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 1, 1: 0, 2: 5, 3: 25, 4: 301}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920704517_920704527 22 Left 920704517 1:208241955-208241977 CCTCCAGGCCACCACCAAGGAGA 0: 1
1: 0
2: 5
3: 25
4: 301
Right 920704527 1:208242000-208242022 TGGTGCTCCGTGAAGAGAGAGGG 0: 1
1: 0
2: 0
3: 10
4: 147
920704517_920704523 2 Left 920704517 1:208241955-208241977 CCTCCAGGCCACCACCAAGGAGA 0: 1
1: 0
2: 5
3: 25
4: 301
Right 920704523 1:208241980-208242002 TCCCAGGTAATTAGTTCAAATGG 0: 1
1: 0
2: 0
3: 9
4: 155
920704517_920704526 21 Left 920704517 1:208241955-208241977 CCTCCAGGCCACCACCAAGGAGA 0: 1
1: 0
2: 5
3: 25
4: 301
Right 920704526 1:208241999-208242021 ATGGTGCTCCGTGAAGAGAGAGG 0: 1
1: 0
2: 2
3: 11
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920704517 Original CRISPR TCTCCTTGGTGGTGGCCTGG AGG (reversed) Intronic