ID: 920704839

View in Genome Browser
Species Human (GRCh38)
Location 1:208243551-208243573
Sequence GGCGCGGGAGAAGCCGCCAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 141}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920704835_920704839 -10 Left 920704835 1:208243538-208243560 CCCCAAAGAGGCGGGCGCGGGAG 0: 1
1: 0
2: 1
3: 8
4: 119
Right 920704839 1:208243551-208243573 GGCGCGGGAGAAGCCGCCACGGG 0: 1
1: 0
2: 0
3: 9
4: 141
920704825_920704839 16 Left 920704825 1:208243512-208243534 CCAAGCCGGGTCTTCTGGGGCCG 0: 1
1: 0
2: 0
3: 3
4: 93
Right 920704839 1:208243551-208243573 GGCGCGGGAGAAGCCGCCACGGG 0: 1
1: 0
2: 0
3: 9
4: 141
920704821_920704839 22 Left 920704821 1:208243506-208243528 CCGCGGCCAAGCCGGGTCTTCTG 0: 1
1: 0
2: 0
3: 6
4: 66
Right 920704839 1:208243551-208243573 GGCGCGGGAGAAGCCGCCACGGG 0: 1
1: 0
2: 0
3: 9
4: 141
920704828_920704839 11 Left 920704828 1:208243517-208243539 CCGGGTCTTCTGGGGCCGGGACC 0: 1
1: 0
2: 0
3: 14
4: 169
Right 920704839 1:208243551-208243573 GGCGCGGGAGAAGCCGCCACGGG 0: 1
1: 0
2: 0
3: 9
4: 141
920704832_920704839 -4 Left 920704832 1:208243532-208243554 CCGGGACCCCAAAGAGGCGGGCG 0: 1
1: 0
2: 0
3: 9
4: 95
Right 920704839 1:208243551-208243573 GGCGCGGGAGAAGCCGCCACGGG 0: 1
1: 0
2: 0
3: 9
4: 141
920704820_920704839 25 Left 920704820 1:208243503-208243525 CCGCCGCGGCCAAGCCGGGTCTT 0: 1
1: 0
2: 0
3: 3
4: 51
Right 920704839 1:208243551-208243573 GGCGCGGGAGAAGCCGCCACGGG 0: 1
1: 0
2: 0
3: 9
4: 141
920704819_920704839 26 Left 920704819 1:208243502-208243524 CCCGCCGCGGCCAAGCCGGGTCT 0: 1
1: 0
2: 0
3: 14
4: 92
Right 920704839 1:208243551-208243573 GGCGCGGGAGAAGCCGCCACGGG 0: 1
1: 0
2: 0
3: 9
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920704839 Original CRISPR GGCGCGGGAGAAGCCGCCAC GGG Intronic
900411973 1:2516622-2516644 GGGGCTGGAGAAGCAGCCTCTGG + Intronic
904252734 1:29236591-29236613 GGCGCGGGGGACGCCGCCCCCGG - Exonic
904642334 1:31939787-31939809 GGTGGGGGAGAAGCACCCACGGG - Intronic
911144796 1:94541791-94541813 GGCGCGGGAGAGCGCGCCGCCGG - Exonic
915563553 1:156701383-156701405 GGCTGGGGAGAAGCTGCCCCTGG - Intronic
918588425 1:186214253-186214275 GGCCCGGGAGAAGCAGCAGCTGG + Intergenic
920704839 1:208243551-208243573 GGCGCGGGAGAAGCCGCCACGGG + Intronic
923195490 1:231662444-231662466 GGCGTGGCTGAAGCCCCCACAGG + Intronic
1063388810 10:5635086-5635108 GGCTGGGGAGAATCTGCCACTGG - Intergenic
1067408671 10:46045846-46045868 GGAGGGGAAGAAGCTGCCACTGG - Intronic
1067713807 10:48671694-48671716 GGCTCGGGCGAGGCAGCCACTGG + Intergenic
1068070256 10:52185658-52185680 GCCGAGGCAGAAGCTGCCACAGG - Intronic
1070398904 10:76035816-76035838 GGCGGGGGAGAAGGGGCCGCTGG - Intronic
1076991715 11:279237-279259 GGCGCCGGAGAACCCACCGCGGG - Intronic
1077383325 11:2257513-2257535 GGCTAGGCAGAAGCAGCCACCGG - Intergenic
1080012422 11:27472317-27472339 GCCGCGGGAGAGGCCGGCGCGGG - Exonic
1081648278 11:44805100-44805122 TGGGCGGGAGCAGCCGGCACTGG + Intronic
1083265748 11:61546167-61546189 GCTGGGGGAGAAGCCGGCACCGG - Exonic
1083744221 11:64726315-64726337 GGGTTGGGAGAAGCCACCACCGG + Intergenic
1083893263 11:65607456-65607478 GGCGCGCGAGCAGCGGTCACAGG - Exonic
1084736504 11:71108813-71108835 GCAGCAGGAGAAGCCGGCACGGG - Intronic
1089814196 11:121158004-121158026 GGTGCGGAAGACGCCGCCGCCGG - Exonic
1094564979 12:31590999-31591021 GGCGCGGGGGAAGCGGCCGCGGG + Exonic
1095932000 12:47636758-47636780 GGCATGGGGGAAGACGCCACAGG + Intergenic
1097938459 12:65278774-65278796 GGCGCGGGAGGGTCCGCCGCGGG - Exonic
1100607796 12:96165995-96166017 GGCTCAGAAGAAGCTGCCACAGG + Intergenic
1104289631 12:127455799-127455821 GGAGCGGGAGAAGCCGGGGCCGG + Intergenic
1105349532 13:19602590-19602612 GGCCCGGGAGAAGACGCGCCTGG + Intergenic
1106087626 13:26557692-26557714 GGCGCGAGCGACGCCGCCTCCGG - Intronic
1108063394 13:46553854-46553876 GGCGCGGAAGAAGCGGGCCCTGG + Intronic
1108373411 13:49792521-49792543 GCCGCAGGAGTAGCCGCCGCCGG - Exonic
1113374780 13:109754924-109754946 GGCACTGGGGAAGCCCCCACGGG + Exonic
1113632029 13:111894322-111894344 AGCGTGGGAGAGGCCGCCTCTGG - Intergenic
1114220912 14:20695672-20695694 GGAGCAGGAGAAGCCACCATAGG - Intronic
1114485561 14:23059414-23059436 GGAGCGGGAGAAGCGGCGAAAGG - Exonic
1114878195 14:26750284-26750306 AGCGCGGGAGAAGGCCCCCCCGG + Intergenic
1122600312 14:102918048-102918070 GGGGAGGAAGGAGCCGCCACTGG - Intergenic
1124696847 15:31870659-31870681 GGCGGGGGAGGAGAGGCCACCGG - Intronic
1125723597 15:41856915-41856937 GGTGCAGGAGAAGCTGCCTCTGG - Exonic
1128254957 15:66189595-66189617 GGCGCAGGAGAGGGCACCACTGG + Intronic
1129463700 15:75712419-75712441 GGGGCGGGAGCAGGCGCCCCAGG - Intronic
1132906503 16:2285282-2285304 GGCGAGGGGGCAGCCGCCAGGGG + Intronic
1134149899 16:11797311-11797333 CGCCCGGGAGACGCCGCCATTGG + Intergenic
1138178778 16:54929019-54929041 GCCGCCGGCGAGGCCGCCACTGG + Intergenic
1139466238 16:67155539-67155561 GGCGCGGAGGAAGCGGCCACAGG + Exonic
1140972717 16:80028842-80028864 GGCACAGAATAAGCCGCCACTGG - Intergenic
1142188592 16:88706563-88706585 GGCGCCTGAGGAGCCGCCCCCGG + Exonic
1142300982 16:89257603-89257625 GGCGAGGGAGCAGCAGCCACCGG - Intergenic
1142406447 16:89892921-89892943 GGCGCAGGAGAAGCGGCCGTGGG - Intronic
1142849607 17:2697955-2697977 GGCGCGGGGGAAGCCGGCGCGGG + Exonic
1143492888 17:7294346-7294368 GGCGGGGGCGGAGCCGCCTCGGG - Exonic
1144565085 17:16353262-16353284 GGCGGTGGAGAAGCCGCCGTCGG - Exonic
1145935346 17:28711755-28711777 GGCGGGGGCGAAGCCGAGACTGG - Exonic
1151723898 17:75873938-75873960 GGGGCTGGAGAAGCCACCTCTGG + Intergenic
1152214478 17:79024465-79024487 GGCGCGGGAGGAGCGGCCGGCGG + Exonic
1152280058 17:79379922-79379944 GGTGCGGGAGAGGCCGCGGCAGG - Intronic
1152773831 17:82187660-82187682 GGCGCGGGGGAAGCTGGCAGGGG + Intronic
1160005243 18:75064197-75064219 GCCCTCGGAGAAGCCGCCACTGG - Exonic
1161461925 19:4402793-4402815 GGCGCCAGGGGAGCCGCCACAGG + Exonic
1162100125 19:8334280-8334302 GTCCCGGCAGAAGCTGCCACAGG + Intronic
1163598292 19:18233077-18233099 GGCGCCGGGGTTGCCGCCACAGG + Exonic
1163607153 19:18281605-18281627 GGCGCAGGAGCCGCCGCCAGTGG - Exonic
925730736 2:6917979-6918001 GGCGCGGGACAGGGCGCCCCGGG + Intronic
925881914 2:8359867-8359889 GGCGCTGGAGAATCAGGCACAGG + Intergenic
926581154 2:14633758-14633780 AGGGGCGGAGAAGCCGCCACAGG - Intronic
929075672 2:38077052-38077074 AGCGCGGGAGGAGCGGCCGCAGG - Intronic
932579261 2:72982996-72983018 GGCCCAGGACAAGCTGCCACAGG + Intronic
935154477 2:100470981-100471003 GGCGCGGGAGGAGCGCACACTGG + Intronic
935396841 2:102619142-102619164 GGCGCGCGGGGAGGCGCCACAGG - Intergenic
938251962 2:129822358-129822380 GGCTCTGCAGCAGCCGCCACCGG + Intergenic
938368807 2:130756182-130756204 GGCGAGGGTTAAGCCGCCAGAGG - Intronic
944329424 2:198447786-198447808 GAAGCAGGAGAAGCCGCCCCTGG - Intronic
948347398 2:237310626-237310648 GGCGTGGGAGAAGTGGCCATTGG - Intergenic
1171250053 20:23639842-23639864 GGAGAGGGAGCAGCAGCCACAGG + Intergenic
1171256154 20:23690357-23690379 GGAGAGGGAGCAGCAGCCACGGG + Intergenic
1171481989 20:25461072-25461094 GGCGCGGGAGGTGCAGACACAGG - Intronic
1171484436 20:25476992-25477014 GGAGCTGGAGGAGCCGCCGCAGG - Exonic
1172117945 20:32583235-32583257 GGCGCGGGGGGAGGCGCCTCCGG + Intronic
1175276313 20:57773397-57773419 GGCCAGACAGAAGCCGCCACAGG + Intergenic
1176549793 21:8216197-8216219 GGCCCGGGTGGAGCCGCCGCAGG + Intergenic
1176557684 21:8260426-8260448 GGCCCGGGTGGAGCCGCCGCAGG + Intergenic
1176568718 21:8399231-8399253 GGCCCGGGTGGAGCCGCCGCAGG + Intergenic
1176576632 21:8443466-8443488 GGCCCGGGTGGAGCCGCCGCAGG + Intergenic
1176680844 21:9818474-9818496 GGCGTGGGAGAGGGGGCCACGGG + Intergenic
1176681700 21:9822708-9822730 GGCGTGGGAGAGGGGGCCACGGG + Intergenic
1176682259 21:9825518-9825540 GGCGTGGGAGAGGGGGCCACGGG + Intergenic
1176682538 21:9826927-9826949 GGCGTGGGAGAGGGGGCCACGGG + Intergenic
1176682816 21:9828346-9828368 GGCGTGGGAGAGGGGGCCACGGG + Intergenic
1176683096 21:9829743-9829765 GGCGTGGGAGAGGGGGCCACGGG + Intergenic
1176683375 21:9831153-9831175 GGCGTGGGAGAGGGGGCCACGGG + Intergenic
1176683655 21:9832562-9832584 GGCGTGGGAGAGGGGGCCACGGG + Intergenic
1176683934 21:9833965-9833987 GGCGTGGGAGAGGGGGCCACGGG + Intergenic
1176684212 21:9835374-9835396 GGCGTGGGAGAGGGGGCCACGGG + Intergenic
1178457724 21:32771423-32771445 GCCGCCGGGGAAGCCGCCCCCGG + Exonic
1179911446 21:44451159-44451181 GGCACAGGAGAAGCCGGGACAGG + Intergenic
1180212331 21:46302279-46302301 GGCGGGGGAGGAGCCTCCTCTGG - Intronic
1181168094 22:20993998-20994020 GGCGCGGGAGAGGCTGGCCCAGG + Exonic
1181169420 22:20999951-20999973 GGCACGGGAGAAGCGGGCACAGG - Exonic
1183912829 22:41092062-41092084 GCGGCGGGAGAAGACGCCGCGGG - Exonic
1184317364 22:43706284-43706306 GAGGCAGGAGAAGCAGCCACAGG - Intronic
1203254682 22_KI270733v1_random:132523-132545 GGCCCGGGTGGAGCCGCCGCAGG + Intergenic
1203262738 22_KI270733v1_random:177602-177624 GGCCCGGGTGGAGCCGCCGCAGG + Intergenic
949464750 3:4332969-4332991 GGCTGGGGAGAATCGGCCACTGG + Intronic
950894256 3:16433891-16433913 TGAGCGGGAGAAGACGCCCCTGG - Exonic
952451729 3:33439935-33439957 GGCGCGGGTGAAGCCTCCGGAGG + Exonic
953793956 3:45968583-45968605 GGTGCGGGAGAAGCAGCTACGGG - Exonic
953886987 3:46719702-46719724 GGGGAGGGAGAAGCAGCCTCTGG + Exonic
960423140 3:117474088-117474110 GGTCCGGGAGTAGCCGCCAAGGG + Intergenic
962259655 3:133894853-133894875 GGCGTGGGACAAACAGCCACCGG - Intronic
966724752 3:183099368-183099390 GGCTCGGGAGACGATGCCACCGG + Exonic
967272655 3:187743921-187743943 GGCGCGGGAGGAGCGGGCGCGGG - Intronic
968965599 4:3767628-3767650 GGCGCGCGACAGGCGGCCACCGG - Exonic
970333210 4:15004429-15004451 GCCCCGAGAGAAGCCGCGACGGG + Intronic
970836051 4:20408928-20408950 GGGGTGGGAGAAGCAGCCCCAGG - Intronic
971476893 4:27080900-27080922 TGAGAAGGAGAAGCCGCCACCGG - Intergenic
975683309 4:76897168-76897190 CGCGGAGGAGAAGCCGGCACGGG - Exonic
985653858 5:1119885-1119907 GGGGAGGCAGAAGCAGCCACAGG - Intergenic
995189811 5:109308445-109308467 GTCTCGTGAGAAGCAGCCACGGG - Intergenic
997235988 5:132272157-132272179 GGCGCGCGTGAAGCCGCCCGAGG + Exonic
998985990 5:147757284-147757306 GGCGAGGGAGAACCCTTCACAGG + Intronic
999768106 5:154755829-154755851 GGTGAGGAAGAAGCCGCCGCCGG + Intronic
1001584447 5:172823926-172823948 GGGGCTGGACAAGCAGCCACTGG + Intergenic
1007168699 6:39847254-39847276 GGACTGGGAGAAGCCCCCACTGG - Intronic
1015440437 6:133241266-133241288 GGCGGGGGCGACGTCGCCACCGG - Intronic
1019334588 7:476982-477004 GGGGCAGGTGAAGCAGCCACGGG - Intergenic
1019648432 7:2143261-2143283 CCCGCTGGAGAAGCCACCACTGG - Intronic
1023221889 7:37928053-37928075 GGGGAGGGAGAAGCAGGCACTGG + Intronic
1026787913 7:73313344-73313366 GCCGCAGGAGAAGCCGCGGCTGG + Exonic
1034339011 7:150340669-150340691 GGCGCGGGAGGAGGCGGCTCGGG - Exonic
1034800480 7:154052651-154052673 CGCGCGGGAGGAGCGGCCGCCGG + Intronic
1035025499 7:155822339-155822361 GGAGGGGGAGAGGCTGCCACTGG - Intergenic
1035049538 7:155990548-155990570 AGCTGGGGAGAAGCCGCCCCTGG + Intergenic
1035160965 7:156949753-156949775 AGCGCGGGAGAGGCCGGCCCGGG + Exonic
1036454346 8:8893822-8893844 GGCGCGGGCGAACCCACCAGGGG - Intergenic
1038433505 8:27518714-27518736 TGAGGGGGAGAAGCCCCCACAGG - Intronic
1042246375 8:66712699-66712721 TCCGCGGGAGGAGCCGCCAGCGG + Intronic
1045112521 8:98948312-98948334 AGCGCGGGAAAGGCGGCCACAGG + Exonic
1049726102 8:144147283-144147305 GGCGCGTGGGAAGCCGCCGCAGG + Intergenic
1053003567 9:34590625-34590647 GCCGGGGGAGAAGCCTCCACTGG + Intergenic
1053732875 9:41074804-41074826 GGCGCGGGTGGAGGCGTCACCGG - Intergenic
1054695554 9:68356750-68356772 GGCGCGGGTGGAGGCGTCACCGG + Intronic
1058070161 9:100593753-100593775 GGAGCTGGAGAAGCCTGCACTGG + Intergenic
1059314142 9:113410087-113410109 GGCGCGGGAGATGGCGCTCCGGG + Exonic
1061006233 9:127929816-127929838 GGCGCCAGAGAAGCCCCCGCCGG + Exonic
1061592038 9:131603876-131603898 GGTGCGGGGGAAGCGGCCTCGGG + Intronic
1062019294 9:134308853-134308875 GCCACGGGAGAAGACACCACGGG + Intergenic
1203471083 Un_GL000220v1:115668-115690 GGCCCGGGTGGAGCCGCCGCAGG + Intergenic
1203478904 Un_GL000220v1:159640-159662 GGCCCGGGTGGAGCCGCCGCAGG + Intergenic
1203665160 Un_KI270754v1:16784-16806 GGCGTGGGAGAGGGGGCCACGGG + Intergenic
1203667445 Un_KI270754v1:28059-28081 GGCGTGGGAGAGGGGGCCACGGG + Intergenic
1193246770 X:79238731-79238753 GGCGTGGGAGAAACCCCCATTGG - Intergenic