ID: 920708050

View in Genome Browser
Species Human (GRCh38)
Location 1:208269180-208269202
Sequence AAGGGGGTGAGGAGGGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920708039_920708050 6 Left 920708039 1:208269151-208269173 CCAGAGTGGGGACGGAGATCAGG No data
Right 920708050 1:208269180-208269202 AAGGGGGTGAGGAGGGAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920708050 Original CRISPR AAGGGGGTGAGGAGGGAGAA GGG Intergenic
No off target data available for this crispr