ID: 920713221

View in Genome Browser
Species Human (GRCh38)
Location 1:208315399-208315421
Sequence CTGTAGAAGCAGATGGGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920713213_920713221 2 Left 920713213 1:208315374-208315396 CCCGGCTTCCTCACTCCCTGTAA No data
Right 920713221 1:208315399-208315421 CTGTAGAAGCAGATGGGGAAAGG No data
920713208_920713221 26 Left 920713208 1:208315350-208315372 CCATAGCCACTGTTCACATTGTC No data
Right 920713221 1:208315399-208315421 CTGTAGAAGCAGATGGGGAAAGG No data
920713212_920713221 3 Left 920713212 1:208315373-208315395 CCCCGGCTTCCTCACTCCCTGTA No data
Right 920713221 1:208315399-208315421 CTGTAGAAGCAGATGGGGAAAGG No data
920713215_920713221 -6 Left 920713215 1:208315382-208315404 CCTCACTCCCTGTAACTCTGTAG No data
Right 920713221 1:208315399-208315421 CTGTAGAAGCAGATGGGGAAAGG No data
920713207_920713221 27 Left 920713207 1:208315349-208315371 CCCATAGCCACTGTTCACATTGT No data
Right 920713221 1:208315399-208315421 CTGTAGAAGCAGATGGGGAAAGG No data
920713209_920713221 20 Left 920713209 1:208315356-208315378 CCACTGTTCACATTGTCCCCCGG No data
Right 920713221 1:208315399-208315421 CTGTAGAAGCAGATGGGGAAAGG No data
920713211_920713221 4 Left 920713211 1:208315372-208315394 CCCCCGGCTTCCTCACTCCCTGT No data
Right 920713221 1:208315399-208315421 CTGTAGAAGCAGATGGGGAAAGG No data
920713214_920713221 1 Left 920713214 1:208315375-208315397 CCGGCTTCCTCACTCCCTGTAAC No data
Right 920713221 1:208315399-208315421 CTGTAGAAGCAGATGGGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920713221 Original CRISPR CTGTAGAAGCAGATGGGGAA AGG Intergenic
No off target data available for this crispr