ID: 920714824

View in Genome Browser
Species Human (GRCh38)
Location 1:208330000-208330022
Sequence CTCCAACTGATAAGAGTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920714824_920714827 19 Left 920714824 1:208330000-208330022 CCTGACACTCTTATCAGTTGGAG No data
Right 920714827 1:208330042-208330064 ACCATGTACACCACTTCCTTTGG No data
920714824_920714830 21 Left 920714824 1:208330000-208330022 CCTGACACTCTTATCAGTTGGAG No data
Right 920714830 1:208330044-208330066 CATGTACACCACTTCCTTTGGGG No data
920714824_920714829 20 Left 920714824 1:208330000-208330022 CCTGACACTCTTATCAGTTGGAG No data
Right 920714829 1:208330043-208330065 CCATGTACACCACTTCCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920714824 Original CRISPR CTCCAACTGATAAGAGTGTC AGG (reversed) Intergenic
No off target data available for this crispr