ID: 920718607

View in Genome Browser
Species Human (GRCh38)
Location 1:208365812-208365834
Sequence GTCTCCTAGAGAATCAACCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920718604_920718607 27 Left 920718604 1:208365762-208365784 CCATTTGATTGTAAGCTGCTTGA No data
Right 920718607 1:208365812-208365834 GTCTCCTAGAGAATCAACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920718607 Original CRISPR GTCTCCTAGAGAATCAACCA TGG Intergenic
No off target data available for this crispr