ID: 920728616

View in Genome Browser
Species Human (GRCh38)
Location 1:208461683-208461705
Sequence AACAAACAGGCCCTTTCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920728616_920728623 -2 Left 920728616 1:208461683-208461705 CCAGTGGAAAGGGCCTGTTTGTT No data
Right 920728623 1:208461704-208461726 TTGGGGGGTCAAGTAATCTTTGG No data
920728616_920728625 26 Left 920728616 1:208461683-208461705 CCAGTGGAAAGGGCCTGTTTGTT No data
Right 920728625 1:208461732-208461754 TCAGATTCATACTTGGAGCCAGG No data
920728616_920728624 19 Left 920728616 1:208461683-208461705 CCAGTGGAAAGGGCCTGTTTGTT No data
Right 920728624 1:208461725-208461747 GGACTGCTCAGATTCATACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920728616 Original CRISPR AACAAACAGGCCCTTTCCAC TGG (reversed) Intergenic
No off target data available for this crispr