ID: 920728622

View in Genome Browser
Species Human (GRCh38)
Location 1:208461696-208461718
Sequence TACTTGACCCCCCAACAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920728622_920728624 6 Left 920728622 1:208461696-208461718 CCTGTTTGTTGGGGGGTCAAGTA No data
Right 920728624 1:208461725-208461747 GGACTGCTCAGATTCATACTTGG No data
920728622_920728627 19 Left 920728622 1:208461696-208461718 CCTGTTTGTTGGGGGGTCAAGTA No data
Right 920728627 1:208461738-208461760 TCATACTTGGAGCCAGGAGTGGG No data
920728622_920728625 13 Left 920728622 1:208461696-208461718 CCTGTTTGTTGGGGGGTCAAGTA No data
Right 920728625 1:208461732-208461754 TCAGATTCATACTTGGAGCCAGG No data
920728622_920728626 18 Left 920728622 1:208461696-208461718 CCTGTTTGTTGGGGGGTCAAGTA No data
Right 920728626 1:208461737-208461759 TTCATACTTGGAGCCAGGAGTGG No data
920728622_920728628 20 Left 920728622 1:208461696-208461718 CCTGTTTGTTGGGGGGTCAAGTA No data
Right 920728628 1:208461739-208461761 CATACTTGGAGCCAGGAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920728622 Original CRISPR TACTTGACCCCCCAACAAAC AGG (reversed) Intergenic
No off target data available for this crispr