ID: 920728625

View in Genome Browser
Species Human (GRCh38)
Location 1:208461732-208461754
Sequence TCAGATTCATACTTGGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920728616_920728625 26 Left 920728616 1:208461683-208461705 CCAGTGGAAAGGGCCTGTTTGTT No data
Right 920728625 1:208461732-208461754 TCAGATTCATACTTGGAGCCAGG No data
920728622_920728625 13 Left 920728622 1:208461696-208461718 CCTGTTTGTTGGGGGGTCAAGTA No data
Right 920728625 1:208461732-208461754 TCAGATTCATACTTGGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920728625 Original CRISPR TCAGATTCATACTTGGAGCC AGG Intergenic
No off target data available for this crispr