ID: 920729409

View in Genome Browser
Species Human (GRCh38)
Location 1:208468761-208468783
Sequence ATACCTGCTTATTTTAGAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920729409_920729418 29 Left 920729409 1:208468761-208468783 CCACTTCTAAAATAAGCAGGTAT No data
Right 920729418 1:208468813-208468835 GGCCAGAGGAGCATGTGCTTTGG No data
920729409_920729410 -6 Left 920729409 1:208468761-208468783 CCACTTCTAAAATAAGCAGGTAT No data
Right 920729410 1:208468778-208468800 AGGTATCCTCTCAACACCCATGG No data
920729409_920729415 15 Left 920729409 1:208468761-208468783 CCACTTCTAAAATAAGCAGGTAT No data
Right 920729415 1:208468799-208468821 GGCCTGCAGCCATAGGCCAGAGG No data
920729409_920729412 8 Left 920729409 1:208468761-208468783 CCACTTCTAAAATAAGCAGGTAT No data
Right 920729412 1:208468792-208468814 CACCCATGGCCTGCAGCCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920729409 Original CRISPR ATACCTGCTTATTTTAGAAG TGG (reversed) Intergenic
No off target data available for this crispr