ID: 920730347

View in Genome Browser
Species Human (GRCh38)
Location 1:208477536-208477558
Sequence CAGGAAAATACCACCTGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920730347_920730352 -10 Left 920730347 1:208477536-208477558 CCCAGCCAGGTGGTATTTTCCTG No data
Right 920730352 1:208477549-208477571 TATTTTCCTGTCAAATGTCGGGG No data
920730347_920730354 6 Left 920730347 1:208477536-208477558 CCCAGCCAGGTGGTATTTTCCTG No data
Right 920730354 1:208477565-208477587 GTCGGGGCCTCAAATAGATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920730347 Original CRISPR CAGGAAAATACCACCTGGCT GGG (reversed) Intergenic
No off target data available for this crispr