ID: 920730352

View in Genome Browser
Species Human (GRCh38)
Location 1:208477549-208477571
Sequence TATTTTCCTGTCAAATGTCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920730344_920730352 14 Left 920730344 1:208477512-208477534 CCTAGTTGTTCTGTTTTTCTTTC No data
Right 920730352 1:208477549-208477571 TATTTTCCTGTCAAATGTCGGGG No data
920730347_920730352 -10 Left 920730347 1:208477536-208477558 CCCAGCCAGGTGGTATTTTCCTG No data
Right 920730352 1:208477549-208477571 TATTTTCCTGTCAAATGTCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920730352 Original CRISPR TATTTTCCTGTCAAATGTCG GGG Intergenic
No off target data available for this crispr