ID: 920730354

View in Genome Browser
Species Human (GRCh38)
Location 1:208477565-208477587
Sequence GTCGGGGCCTCAAATAGATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920730348_920730354 5 Left 920730348 1:208477537-208477559 CCAGCCAGGTGGTATTTTCCTGT No data
Right 920730354 1:208477565-208477587 GTCGGGGCCTCAAATAGATCAGG No data
920730344_920730354 30 Left 920730344 1:208477512-208477534 CCTAGTTGTTCTGTTTTTCTTTC No data
Right 920730354 1:208477565-208477587 GTCGGGGCCTCAAATAGATCAGG No data
920730347_920730354 6 Left 920730347 1:208477536-208477558 CCCAGCCAGGTGGTATTTTCCTG No data
Right 920730354 1:208477565-208477587 GTCGGGGCCTCAAATAGATCAGG No data
920730349_920730354 1 Left 920730349 1:208477541-208477563 CCAGGTGGTATTTTCCTGTCAAA No data
Right 920730354 1:208477565-208477587 GTCGGGGCCTCAAATAGATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920730354 Original CRISPR GTCGGGGCCTCAAATAGATC AGG Intergenic
No off target data available for this crispr