ID: 920732942

View in Genome Browser
Species Human (GRCh38)
Location 1:208505087-208505109
Sequence CCGGGTTCAAGGGATTCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920732929_920732942 27 Left 920732929 1:208505037-208505059 CCAGGCTGGAGTGCAGTGGCACA 0: 26280
1: 87232
2: 177120
3: 208812
4: 166229
Right 920732942 1:208505087-208505109 CCGGGTTCAAGGGATTCTGCTGG No data
920732928_920732942 28 Left 920732928 1:208505036-208505058 CCCAGGCTGGAGTGCAGTGGCAC 0: 52453
1: 149973
2: 210600
3: 182318
4: 112095
Right 920732942 1:208505087-208505109 CCGGGTTCAAGGGATTCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920732942 Original CRISPR CCGGGTTCAAGGGATTCTGC TGG Intergenic
No off target data available for this crispr