ID: 920739271

View in Genome Browser
Species Human (GRCh38)
Location 1:208564767-208564789
Sequence CTAATTACACAGGTGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920739264_920739271 25 Left 920739264 1:208564719-208564741 CCCCAAACACTCAGCATGGTGCT No data
Right 920739271 1:208564767-208564789 CTAATTACACAGGTGGAGCTGGG No data
920739267_920739271 -9 Left 920739267 1:208564753-208564775 CCTATTCTTCAGTACTAATTACA No data
Right 920739271 1:208564767-208564789 CTAATTACACAGGTGGAGCTGGG No data
920739266_920739271 23 Left 920739266 1:208564721-208564743 CCAAACACTCAGCATGGTGCTGT No data
Right 920739271 1:208564767-208564789 CTAATTACACAGGTGGAGCTGGG No data
920739265_920739271 24 Left 920739265 1:208564720-208564742 CCCAAACACTCAGCATGGTGCTG No data
Right 920739271 1:208564767-208564789 CTAATTACACAGGTGGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920739271 Original CRISPR CTAATTACACAGGTGGAGCT GGG Intergenic
No off target data available for this crispr