ID: 920742889

View in Genome Browser
Species Human (GRCh38)
Location 1:208598150-208598172
Sequence CTGGGAAAAGAGATGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920742881_920742889 -2 Left 920742881 1:208598129-208598151 CCAAGAAAAGAGTGGCCCTTTCT No data
Right 920742889 1:208598150-208598172 CTGGGAAAAGAGATGGAGGAGGG No data
920742878_920742889 29 Left 920742878 1:208598098-208598120 CCGCACTAAGTGGCCAGATAAAA No data
Right 920742889 1:208598150-208598172 CTGGGAAAAGAGATGGAGGAGGG No data
920742879_920742889 16 Left 920742879 1:208598111-208598133 CCAGATAAAATGTTGATGCCAAG No data
Right 920742889 1:208598150-208598172 CTGGGAAAAGAGATGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920742889 Original CRISPR CTGGGAAAAGAGATGGAGGA GGG Intergenic
No off target data available for this crispr