ID: 920743192

View in Genome Browser
Species Human (GRCh38)
Location 1:208600638-208600660
Sequence CAGGGTGACCAGTGCTCTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920743185_920743192 1 Left 920743185 1:208600614-208600636 CCTCAGGAGGTCATTCTCCCCCT No data
Right 920743192 1:208600638-208600660 CAGGGTGACCAGTGCTCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920743192 Original CRISPR CAGGGTGACCAGTGCTCTGA TGG Intergenic
No off target data available for this crispr