ID: 920746586

View in Genome Browser
Species Human (GRCh38)
Location 1:208634838-208634860
Sequence GCTGGGACATTGATCTTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920746584_920746586 -8 Left 920746584 1:208634823-208634845 CCTGCCTGGCTGGAAGCTGGGAC No data
Right 920746586 1:208634838-208634860 GCTGGGACATTGATCTTTCCTGG No data
920746578_920746586 18 Left 920746578 1:208634797-208634819 CCTACTGCAAGTAAGAGGGAACT No data
Right 920746586 1:208634838-208634860 GCTGGGACATTGATCTTTCCTGG No data
920746577_920746586 19 Left 920746577 1:208634796-208634818 CCCTACTGCAAGTAAGAGGGAAC No data
Right 920746586 1:208634838-208634860 GCTGGGACATTGATCTTTCCTGG No data
920746581_920746586 -5 Left 920746581 1:208634820-208634842 CCTCCTGCCTGGCTGGAAGCTGG No data
Right 920746586 1:208634838-208634860 GCTGGGACATTGATCTTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920746586 Original CRISPR GCTGGGACATTGATCTTTCC TGG Intergenic
No off target data available for this crispr