ID: 920748693

View in Genome Browser
Species Human (GRCh38)
Location 1:208653427-208653449
Sequence CTGAACTCCTTGGGAAAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920748693_920748697 18 Left 920748693 1:208653427-208653449 CCATTCTTTCCCAAGGAGTTCAG No data
Right 920748697 1:208653468-208653490 TCTTCCTGAAGCCTTCAGAATGG No data
920748693_920748699 26 Left 920748693 1:208653427-208653449 CCATTCTTTCCCAAGGAGTTCAG No data
Right 920748699 1:208653476-208653498 AAGCCTTCAGAATGGTTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920748693 Original CRISPR CTGAACTCCTTGGGAAAGAA TGG (reversed) Intergenic
No off target data available for this crispr