ID: 920748810

View in Genome Browser
Species Human (GRCh38)
Location 1:208654712-208654734
Sequence TAAGCTCCATAATATGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920748810_920748815 -2 Left 920748810 1:208654712-208654734 CCCTGCCCATATTATGGAGCTTA No data
Right 920748815 1:208654733-208654755 TATGCACTCCTGGCACACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920748810 Original CRISPR TAAGCTCCATAATATGGGCA GGG (reversed) Intergenic
No off target data available for this crispr