ID: 920749247

View in Genome Browser
Species Human (GRCh38)
Location 1:208658506-208658528
Sequence GGTCTCCTGAAGCTCTATCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920749247_920749252 8 Left 920749247 1:208658506-208658528 CCTAGATAGAGCTTCAGGAGACC No data
Right 920749252 1:208658537-208658559 AACCCATTGCCAGTGACTGGAGG No data
920749247_920749255 16 Left 920749247 1:208658506-208658528 CCTAGATAGAGCTTCAGGAGACC No data
Right 920749255 1:208658545-208658567 GCCAGTGACTGGAGGACACAAGG No data
920749247_920749257 27 Left 920749247 1:208658506-208658528 CCTAGATAGAGCTTCAGGAGACC No data
Right 920749257 1:208658556-208658578 GAGGACACAAGGTCTCAACTTGG No data
920749247_920749251 5 Left 920749247 1:208658506-208658528 CCTAGATAGAGCTTCAGGAGACC No data
Right 920749251 1:208658534-208658556 GTAAACCCATTGCCAGTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920749247 Original CRISPR GGTCTCCTGAAGCTCTATCT AGG (reversed) Intergenic
No off target data available for this crispr