ID: 920749252

View in Genome Browser
Species Human (GRCh38)
Location 1:208658537-208658559
Sequence AACCCATTGCCAGTGACTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920749247_920749252 8 Left 920749247 1:208658506-208658528 CCTAGATAGAGCTTCAGGAGACC No data
Right 920749252 1:208658537-208658559 AACCCATTGCCAGTGACTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920749252 Original CRISPR AACCCATTGCCAGTGACTGG AGG Intergenic
No off target data available for this crispr