ID: 920749255

View in Genome Browser
Species Human (GRCh38)
Location 1:208658545-208658567
Sequence GCCAGTGACTGGAGGACACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920749250_920749255 -5 Left 920749250 1:208658527-208658549 CCTCAGGGTAAACCCATTGCCAG No data
Right 920749255 1:208658545-208658567 GCCAGTGACTGGAGGACACAAGG No data
920749247_920749255 16 Left 920749247 1:208658506-208658528 CCTAGATAGAGCTTCAGGAGACC No data
Right 920749255 1:208658545-208658567 GCCAGTGACTGGAGGACACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920749255 Original CRISPR GCCAGTGACTGGAGGACACA AGG Intergenic
No off target data available for this crispr